G63939 (atp5c1,LOC107675979)



Basic Information


Item Value
gene id G63939
gene name atp5c1,LOC107675979
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 14090379 ~ 14093476 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU86283
AACCAATTCAGCTCCTACAAGGTAAAATTCCAGTGAGAGGCAGTAAGAGACAATAAAATAACAGGAGAAAGAAGCCGTACCTGTACAGCAGACCCCTCAGCTTGTCTCCCACATTCACCACCATCACCTCTTTGCCAGCACCGGAGAGCTTGGCGATTTCGTTCTTCATGGCTTTAGCCACGCTGCTGTGGATGGCACCGCACAGCCCACGATCAGACGACACGCCAATGAGCAAGTGCTTGTTCTTATCATCTGTAGCCTTTATGTCAGCCTTCTCATACAGCGACAGAGCACCAGTGCCATAGACACGAGCTGGCTTCAAGGCCCTCTCAGCCCTAGCATACTTGGCGGCGGCCACCATCTTCATGGACTTGGTGATCTTCTGGATGTTCTTGACGGACTTCAACCGAATGGTGATGTCCTTCAAGGTAGCCATGTTCCTGACCTGCCCACATTGTGGGAGGAACACCACCGCGCTGGCCCTGCAGAACATGTTCACTTCCAATGAAGGTCAGAC

Function


symbol description
atp5c1 Predicted to contribute to proton-transporting ATP synthase activity, rotational mechanism. Predicted to be involved in mitochondrial ATP synthesis coupled proton transport. Predicted to act upstream of or within ATP biosynthetic process and ion transport. Located in mitochondrial inner membrane and myelin sheath. Is expressed in several structures, including alimentary system; genitourinary system; integumental system; nervous system; and sensory organ. Orthologous to human ATP5F1C (ATP synthase F1 subunit gamma).

NR:

description
PREDICTED: ATP synthase subunit gamma, mitochondrial isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU86283 True 517 lncRNA 0.52 4 14090379 14093476

Neighbor


gene id symbol gene type direction distance location
kin kin coding downstream 827 14080289 ~ 14089552 (-)
sfmbt2 sfmbt2 coding downstream 92886 13922539 ~ 13997493 (-)
LOC103038708 NA coding downstream 334897 13712234 ~ 13755482 (-)
LOC103026945 LOC108427039 coding downstream 397529 13646396 ~ 13692850 (-)
vezt vezt coding downstream 583085 13474323 ~ 13507294 (-)
snd1 snd1,LOC107738807,LOC107732977 coding upstream 1177387 15270863 ~ 15554632 (-)
LOC103045938 LOC108432519 coding upstream 1485398 15578874 ~ 15624348 (-)
akap14 NA coding upstream 1832070 15925546 ~ 15927271 (-)
LOC111192960 NA coding upstream 2254083 16347559 ~ 16351713 (-)
scaf11 NA coding upstream 2337824 16431300 ~ 16450766 (-)
G63904 NA non-coding downstream 98587 13991255 ~ 13991792 (-)
G63852 rbm17,LOC107755150,LOC107748463 non-coding downstream 321328 13764764 ~ 13769051 (-)
G63849 NA non-coding downstream 330376 13758263 ~ 13760003 (-)
G63830 NA non-coding downstream 528285 13561359 ~ 13562094 (-)
G63773 NA non-coding downstream 546811 13542626 ~ 13543568 (-)
G63947 taf3,LOC107555823,LOC107748456,LOC107675973 non-coding upstream 98212 14191688 ~ 14196509 (-)
G63955 gata3 non-coding upstream 132789 14226265 ~ 14227320 (-)
G63963 NA non-coding upstream 173929 14267405 ~ 14267758 (-)
G63993 NA non-coding upstream 380549 14474025 ~ 14474408 (-)
G63994 NA non-coding upstream 394717 14488193 ~ 14488804 (-)
prkcq prkcq,LOC107748461,LOC107675981,LOC107555829 other downstream 202511 13841193 ~ 13887868 (-)
LOC103025415 iqsec3,LOC107689235 other downstream 1062881 12805971 ~ 13027498 (-)
slc2a13 LOC108427068,LOC108280145,LOC107689243 other downstream 1589716 12365468 ~ 12500663 (-)
G63516 NA other downstream 1709823 12320555 ~ 12380556 (-)
G63217 NA other downstream 3679148 10314799 ~ 10411231 (-)
G64034 NA other upstream 691845 14785321 ~ 14786149 (-)
LOC111192906 NA other upstream 896753 14990229 ~ 14992730 (-)
G64060 NA other upstream 900688 14994164 ~ 14994832 (-)
LOC103027187 NA other upstream 1577830 15671306 ~ 15867795 (-)
G64387 NA other upstream 2491589 16585065 ~ 16585647 (-)

Expression



Co-expression Network