G63963



Basic Information


Item Value
gene id G63963
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 14267405 ~ 14267758 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU86309
tgagaacagtctggattgctttgtgtgaatgtttgtttggtaaagcgaggcgacgttcattggaggagcgcagcggccgggaggtagcgtaagccttcaggagcgagtgcaggtaggaaggagctgttctgtcatcaccttgtaggcgattgtaagagttttgaatttgatgcgagcatcaactggtagccaggggagctcaatgagcagcggggtgacatgtgcccgttttggttggttgaagaccagacgtgctgctgcattctggatcatttggagtggttttactacacaggccgggaggccagttagcagggcattgcagtagtcgaggcgtgagatgacgaccgcttg

Function


GO:

id name namespace
GO:0010035 response to inorganic substance biological_process
GO:0010038 response to metal ion biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU86309 True 354 lncRNA 0.53 1 14267405 14267758

Neighbor


gene id symbol gene type direction distance location
kin kin coding downstream 177853 14080289 ~ 14089552 (-)
sfmbt2 sfmbt2 coding downstream 269912 13922539 ~ 13997493 (-)
LOC103038708 NA coding downstream 511923 13712234 ~ 13755482 (-)
LOC103026945 LOC108427039 coding downstream 574555 13646396 ~ 13692850 (-)
vezt vezt coding downstream 760111 13474323 ~ 13507294 (-)
snd1 snd1,LOC107738807,LOC107732977 coding upstream 1003105 15270863 ~ 15554632 (-)
LOC103045938 LOC108432519 coding upstream 1311116 15578874 ~ 15624348 (-)
akap14 NA coding upstream 1657788 15925546 ~ 15927271 (-)
LOC111192960 NA coding upstream 2079801 16347559 ~ 16351713 (-)
scaf11 NA coding upstream 2163542 16431300 ~ 16450766 (-)
G63955 gata3 non-coding downstream 40085 14226265 ~ 14227320 (-)
G63947 taf3,LOC107555823,LOC107748456,LOC107675973 non-coding downstream 70896 14191688 ~ 14196509 (-)
G63939 atp5c1,LOC107675979 non-coding downstream 173929 14090379 ~ 14093476 (-)
G63904 NA non-coding downstream 275613 13991255 ~ 13991792 (-)
G63852 rbm17,LOC107755150,LOC107748463 non-coding downstream 498354 13764764 ~ 13769051 (-)
G63993 NA non-coding upstream 206267 14474025 ~ 14474408 (-)
G63994 NA non-coding upstream 220435 14488193 ~ 14488804 (-)
G63997 NA non-coding upstream 297891 14565649 ~ 14565997 (-)
G64000 NA non-coding upstream 330990 14598748 ~ 14599009 (-)
G64011 NA non-coding upstream 451044 14718802 ~ 14722535 (-)
prkcq prkcq,LOC107748461,LOC107675981,LOC107555829 other downstream 379537 13841193 ~ 13887868 (-)
LOC103025415 iqsec3,LOC107689235 other downstream 1239907 12805971 ~ 13027498 (-)
slc2a13 LOC108427068,LOC108280145,LOC107689243 other downstream 1766742 12365468 ~ 12500663 (-)
G63516 NA other downstream 1886849 12320555 ~ 12380556 (-)
G63217 NA other downstream 3856174 10314799 ~ 10411231 (-)
G64034 NA other upstream 517563 14785321 ~ 14786149 (-)
LOC111192906 NA other upstream 722471 14990229 ~ 14992730 (-)
G64060 NA other upstream 726406 14994164 ~ 14994832 (-)
LOC103027187 NA other upstream 1403548 15671306 ~ 15867795 (-)
G64387 NA other upstream 2317307 16585065 ~ 16585647 (-)

Expression



Co-expression Network