G64011



Basic Information


Item Value
gene id G64011
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 14718802 ~ 14722535 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU86366
tgataataaaacacagtggatcaacaccagcagatgacatgtctctccaaaccatcactgattggtggaaacttcacactagacctcgagcagtttggactgtgtgtctctccacttttcctccagactcccttgatttacacatgaaatgtaaaatttactgatgatcagtgatggtttggatgtgcaacatctgctggtgttgatccactgtgttttattatcaagtctaaagtcagtgcagttttgttttcccacaaaatcttac

Function


GO:

id name namespace
GO:0031667 response to nutrient levels biological_process
GO:0009991 response to extracellular stimulus biological_process

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption

RNA


RNA id representative length rna type GC content exon number start site end site
TU86366 True 268 lncRNA 0.40 2 14718802 14722535

Neighbor


gene id symbol gene type direction distance location
kin kin coding downstream 629250 14080289 ~ 14089552 (-)
sfmbt2 sfmbt2 coding downstream 721309 13922539 ~ 13997493 (-)
LOC103038708 NA coding downstream 963320 13712234 ~ 13755482 (-)
LOC103026945 LOC108427039 coding downstream 1025952 13646396 ~ 13692850 (-)
vezt vezt coding downstream 1211508 13474323 ~ 13507294 (-)
snd1 snd1,LOC107738807,LOC107732977 coding upstream 548328 15270863 ~ 15554632 (-)
LOC103045938 LOC108432519 coding upstream 856339 15578874 ~ 15624348 (-)
akap14 NA coding upstream 1203011 15925546 ~ 15927271 (-)
LOC111192960 NA coding upstream 1625024 16347559 ~ 16351713 (-)
scaf11 NA coding upstream 1708765 16431300 ~ 16450766 (-)
G64000 NA non-coding downstream 119793 14598748 ~ 14599009 (-)
G63997 NA non-coding downstream 152805 14565649 ~ 14565997 (-)
G63994 NA non-coding downstream 229998 14488193 ~ 14488804 (-)
G63993 NA non-coding downstream 244394 14474025 ~ 14474408 (-)
G63963 NA non-coding downstream 451044 14267405 ~ 14267758 (-)
G64018 NA non-coding upstream 50340 14772875 ~ 14773164 (-)
G64043 NA non-coding upstream 157810 14880345 ~ 14880579 (-)
G64048 NA non-coding upstream 161477 14884012 ~ 14957407 (-)
G64054 NA non-coding upstream 257187 14979722 ~ 14979957 (-)
G64063 NA non-coding upstream 277274 14999809 ~ 15000025 (-)
prkcq prkcq,LOC107748461,LOC107675981,LOC107555829 other downstream 830934 13841193 ~ 13887868 (-)
LOC103025415 iqsec3,LOC107689235 other downstream 1691304 12805971 ~ 13027498 (-)
slc2a13 LOC108427068,LOC108280145,LOC107689243 other downstream 2218139 12365468 ~ 12500663 (-)
G63516 NA other downstream 2338246 12320555 ~ 12380556 (-)
G63217 NA other downstream 4307571 10314799 ~ 10411231 (-)
G64034 NA other upstream 62786 14785321 ~ 14786149 (-)
LOC111192906 NA other upstream 267694 14990229 ~ 14992730 (-)
G64060 NA other upstream 271629 14994164 ~ 14994832 (-)
LOC103027187 NA other upstream 948771 15671306 ~ 15867795 (-)
G64387 NA other upstream 1862530 16585065 ~ 16585647 (-)

Expression



Co-expression Network