G65575 (nav3)


Basic Information

Item Value
gene id G65575
gene name nav3
gene type unknown
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035903.1
NCBI id CM008306.1
chromosome length 40813162
location 21024175 ~ 21024574 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU88525
TCCGACTCCACTGGAGGATTTGGCGGGTCGAGGAAGCGAGCGGTACTGCAGCGTTACCTTCGACGTCCCGACTCCCAGCAGGACGCCATCGTCTTGGTGCTGACACCCGTCCAGACTCGTCTTTCTCCCAGGTCCACCCTTCCCTATGCCAGCAGATTTGGGAATTTTGCCCAGTGTGGCCGAACCGCTGGATAACGTAGCACCGCTGGCGGTGACGATCGGCCCGGACGGACACGGAATCTTCTTGAATCCAAAAGATCCGGTAGCTGCAGGACGGCCGATGCCAGACGGTGGCTTCTTGCCCTCGTCTCCACTGCTTTTACCTGCATCTGATGGTGAGCGCTGGATGCTGGGGGATTTACACGGAGACTTGCCTTTCTCTGACGCTTTAGCGTCGTCT

Function

symbol description
nav3 Enables actin binding activity. Acts upstream of or within liver morphogenesis and pancreas development. Located in Golgi apparatus; filopodium; and lamellipodium. Is expressed in several structures, including cardiovascular system; digestive system; liver primordium; nervous system; and periderm. Orthologous to human NAV3 (neuron navigator 3).

NR:

description
PREDICTED: neuron navigator 3 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU88525 True 400 TUCP 0.59 1 21024175 21024574

Neighbor

gene id symbol gene type direction distance location
LOC111192985 LOC107688027,LOC107751101,LOC107731862,LOC106606817,LOC106579815,LOC107570926 coding upstream 428874 20593666 ~ 20595301 (+)
pawr LOC108434155,LOC108434154 coding upstream 526514 20417512 ~ 20497661 (+)
ppp1r12a ppp1r12a coding upstream 626208 20299702 ~ 20397967 (+)
rps16 rps16,LOC103382554 coding upstream 757978 20262580 ~ 20266197 (+)
lin7a lin7a coding upstream 850871 20155055 ~ 20173304 (+)
tmem214 tmem214,LOC104961504,LOC106608390 coding downstream 386275 21410849 ~ 21438210 (+)
msgn1 NA coding downstream 690878 21715452 ~ 21716948 (+)
tmem19 tmem19,LOC107719866,LOC107687559 coding downstream 880685 21905259 ~ 21911577 (+)
rab21 rab21,zgc:154045,LOC106609839,LOC107687573,LOC107690748 coding downstream 908195 21932769 ~ 21956278 (+)
ptprr ptprr coding downstream 969536 21994110 ~ 22100636 (+)
LOC111192878 NA non-coding upstream 65797 20957703 ~ 20958378 (+)
G65564 NA non-coding upstream 67096 20956851 ~ 20957079 (+)
LOC111192987 NA non-coding upstream 189322 20832020 ~ 20834853 (+)
G65494 NA non-coding upstream 274094 20744976 ~ 20750081 (+)
G65482 NA non-coding upstream 455070 20567363 ~ 20569105 (+)
G65576 nav3 non-coding downstream 1228 21025802 ~ 21026070 (+)
G65585 NA non-coding downstream 191361 21215935 ~ 21217263 (+)
G65626 NA non-coding downstream 334796 21359370 ~ 21359667 (+)
G65630 NA non-coding downstream 346476 21371050 ~ 21372121 (+)
G65633 NA non-coding downstream 352672 21377246 ~ 21377776 (+)
G65565 NA other upstream 66540 20957135 ~ 20957635 (+)
LOC103037311 LOC103037311,LOC103358095,LOC106514816,LOC107386321 other upstream 1229850 19780663 ~ 19794325 (+)
alyref alyref,LOC107743018,LOC107665635,LOC107748861 other upstream 1683296 19280292 ~ 19340879 (+)
LOC103044219 mcrip1,fam195b,LOC107654575 other upstream 1744658 19276802 ~ 19279517 (+)
LOC103045528 NA other upstream 1746104 19223209 ~ 19278071 (+)
agbl5 NA other downstream 415835 21440409 ~ 21549162 (+)
gen1 gen1 other downstream 605213 21629787 ~ 21715437 (+)
ccdc167 NA other downstream 1914981 22939555 ~ 22949199 (+)
c7h11orf98 cunh11orf98,c19h11orf98 other downstream 1974796 22999370 ~ 23003468 (+)
crebl2 crebl2,LOC107707978 other downstream 2106506 23131080 ~ 23138011 (+)

Expression


Co-expression Network