G113642 (acox1)


Basic Information

Item Value
gene id G113642
gene name acox1
gene type unknown
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035909.1
NCBI id CM008312.1
chromosome length 44161018
location 25261386 ~ 25262221 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU153545
AGGCCTTCACTACCTGGGTTACTAACACAGGGATAGAGGTGTGCCGGATGTCCTGTGGTGGACATGGCTACTCGCGCTGCAGCAGCCTACCAGACATCTATGTCATCTTTACTGCCACTTGCACCTACGAAGGAGAGAACACTGTCATGATGCTGCAGACAGCCAGATATTTGGTGAAGAGTTACAGACAGGCACGTGAGGGTCGGCAGCTCAGTGGGATCGTATCTTACCTCAATGAACAGCAGCGGGTGCAGCCTGTCTCCTCCAGGCCCACGGTTGTCAACATCATTGACCTGTCCAGCCTGGTAGAGGCATACAAGCTTCGTGC

Function

symbol description
acox1 Predicted to enable fatty acid binding activity; flavin adenine dinucleotide binding activity; and palmitoyl-CoA oxidase activity. Predicted to be involved in fatty acid beta-oxidation using acyl-CoA oxidase; lipid homeostasis; and very long-chain fatty acid metabolic process. Predicted to act upstream of or within fatty acid beta-oxidation. Predicted to be active in peroxisome. Is expressed in several structures, including female organism; heart; immature eye; liver; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in peroxisomal acyl-CoA oxidase deficiency. Orthologous to human ACOX1 (acyl-CoA oxidase 1).

NR:

description
PREDICTED: peroxisomal acyl-coenzyme A oxidase 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU153545 True 328 TUCP 0.54 2 25261386 25262221

Neighbor

gene id symbol gene type direction distance location
LOC111193666 NA coding upstream 2213 25257569 ~ 25259173 (+)
acox1 acox1 coding upstream 28985 25209804 ~ 25232401 (+)
evpl evpl coding upstream 56952 25175512 ~ 25204434 (+)
srp68 srp68 coding upstream 92387 25146097 ~ 25168999 (+)
polg2 NA coding upstream 131070 25126447 ~ 25130316 (+)
rhbdf2 rhbdf2 coding downstream 3254 25265475 ~ 25319352 (+)
LOC103023085 slc25a6,LOC108424711,LOC108273102,LOC108426068,LOC107752260,LOC107702905,LOC107557761,LOC103140121,LOC106926499 coding downstream 70920 25333141 ~ 25341081 (+)
LOC103024355 LOC103024355,LOC108424794,LOC108273264,LOC106588570,LOC107681484,LOC107711600 coding downstream 266356 25528577 ~ 25536540 (+)
prpsap1 prpsap1,LOC106606986,LOC107731682,LOC106588225,LOC105013149 coding downstream 275472 25537693 ~ 25570327 (+)
LOC103034703 pltp,LOC107696437,LOC107744357,LOC107740259,LOC107666176,LOC107560511,LOC107587597 coding downstream 395632 25657853 ~ 25670407 (+)
G113552 NA non-coding upstream 160503 25037538 ~ 25100883 (+)
G113557 NA non-coding upstream 185445 25075205 ~ 25075941 (+)
G113457 NA non-coding upstream 304472 24956470 ~ 24956914 (+)
G113456 NA non-coding upstream 317633 24943428 ~ 24943753 (+)
G113451 NA non-coding upstream 374271 24885431 ~ 24887115 (+)
G113680 NA non-coding downstream 138233 25400454 ~ 25401186 (+)
G113682 NA non-coding downstream 156398 25418619 ~ 25510014 (+)
G113683 NA non-coding downstream 164239 25426460 ~ 25426736 (+)
G113703 NA non-coding downstream 346187 25608408 ~ 25608878 (+)
G113707 ctsa,LOC107587598,LOC107696438,LOC107744356 non-coding downstream 409248 25671469 ~ 25683917 (+)
LOC103030782 NA other upstream 7256 25250384 ~ 25254130 (+)
G113422 NA other upstream 786048 24474078 ~ 24475338 (+)
LOC103027315 manbal,LOC107666036,LOC107744407 other upstream 841707 24411009 ~ 24419679 (+)
LOC103026829 LOC108272263,LOC108410934,LOC106582708,LOC107744363,LOC107696444,LOC107587591,LOC107560506,LOC107666116 other upstream 859655 24298179 ~ 24401731 (+)
LOC103026336 mybph,LOC108441582,LOC107587590,LOC107740275,LOC107696393,LOC107744364 other upstream 973159 24261682 ~ 24288227 (+)
ube2o ube2o other downstream 79932 25342153 ~ 25396983 (+)
G113979 snrpb,LOC101173217 other downstream 2085228 27347449 ~ 27352444 (+)
LOC103037845 necab3,LOC108431835,LOC108271560,LOC107666033,LOC107553901,LOC107740282,LOC107587636,LOC107744391 other downstream 2128793 27391014 ~ 27489522 (+)
LOC103044650 LOC108427558 other downstream 3945522 29207743 ~ 29281311 (+)
LOC111193669 NA other downstream 4620150 29882371 ~ 29887978 (+)

Expression


Co-expression Network