G114439 (tardbp,LOC108427558,LOC105025427)


Basic Information

Item Value
gene id G114439
gene name tardbp,LOC108427558,LOC105025427
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035909.1
NCBI id CM008312.1
chromosome length 44161018
location 29281458 ~ 29282414 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU154666
ACCTGATCATCAGCAAAAGTAACAAAAGCAAAAGCTCGGAAAGGCTTTGGGATGAAGACGTCTGTGACCTCGCCGTACTGCATGAAGAACTGCCGCAGGTCATCGGCGGTCATGTCCTCTGTGCAGCGCCCCACAAATACCTTTCTGCTCCTCATTGGCTCATCAGGACCTTGCTAGTTCGGCAATTTGCAGTCGCACCATCTCCCGTCGATCATATGCCGCTGAGCAATGACTTTACTTTGCGTTTCCCATTCACCAAATCTCACAAATCCGAACCCCTTTGAATTTCCAGTCTTAACATCACGCTTTACCTGGGAGAGGCAGGGAGAGATCAGAACACAGTGA

Function

symbol description
tardbp Enables double-stranded DNA binding activity; identical protein binding activity; and mRNA 3'-UTR binding activity. Involved in several processes, including negative regulation by host of viral transcription; nuclear inner membrane organization; and regulation of mRNA stability. Located in nucleoplasm. Implicated in Parkinson's disease; amyotrophic lateral sclerosis; amyotrophic lateral sclerosis type 10; and motor neuron disease. Biomarker of Lewy body dementia; neurodegenerative disease (multiple); and progressive supranuclear palsy.

NR:

description
PREDICTED: TAR DNA-binding protein 43-like isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU154666 True 345 lncRNA 0.50 2 29281458 29282414

Neighbor

gene id symbol gene type direction distance location
rbp7 rbp7,LOC107713528,LOC107666991,LOC107555975,LOC107708738 coding upstream 10009 29267706 ~ 29271449 (+)
h6pd h6pd coding upstream 22375 29245281 ~ 29259083 (+)
shmt2 shmt2,LOC103359782,LOC106515133 coding upstream 149395 29090843 ~ 29132063 (+)
nxph4 nxph4 coding upstream 196014 28994206 ~ 29085444 (+)
stac3 stac3 coding upstream 416675 28849141 ~ 28864783 (+)
c13h3orf67 NA coding downstream 277317 29559731 ~ 29609556 (+)
LOC103032776 NA coding downstream 337946 29620360 ~ 29630245 (+)
LOC111193761 LOC108427564 coding downstream 348511 29630925 ~ 29638287 (+)
LOC103043238 pbrm1l,LOC108427561 coding downstream 400236 29682650 ~ 29697639 (+)
stau1 stau1 coding downstream 416186 29698600 ~ 29709786 (+)
G114433 NA non-coding upstream 20772 29183414 ~ 29260686 (+)
G114402 NA non-coding upstream 295819 28931924 ~ 28985639 (+)
G114405 NA non-coding upstream 304000 28976831 ~ 28977458 (+)
G114400 NA non-coding upstream 349862 28931350 ~ 28931596 (+)
G114399 NA non-coding upstream 354641 28926415 ~ 28926817 (+)
G114474 NA non-coding downstream 175613 29458027 ~ 29557691 (+)
G114475 NA non-coding downstream 192432 29474846 ~ 29475567 (+)
G114480 NA non-coding downstream 239393 29521807 ~ 29599080 (+)
G114623 NA non-coding downstream 550782 29833196 ~ 29833502 (+)
G114627 NA non-coding downstream 556848 29839262 ~ 29839720 (+)
LOC103044650 LOC108427558 other upstream 147 29207743 ~ 29281311 (+)
LOC103037845 necab3,LOC108431835,LOC108271560,LOC107666033,LOC107553901,LOC107740282,LOC107587636,LOC107744391 other upstream 1791936 27391014 ~ 27489522 (+)
G113979 snrpb,LOC101173217 other upstream 1929014 27347449 ~ 27352444 (+)
ube2o ube2o other upstream 3884475 25342153 ~ 25396983 (+)
G113642 acox1 other upstream 4019237 25261386 ~ 25262221 (+)
LOC111193669 NA other downstream 599957 29882371 ~ 29887978 (+)
G114698 NA other downstream 843921 30126335 ~ 30129896 (+)
G114841 NA other downstream 1567895 30850309 ~ 30880553 (+)
G115024 ngf,LOC103031633,LOC105909845 other downstream 2610871 31893285 ~ 31894351 (+)
LOC103031324 kcna3a,LOC108427600,LOC108271529,LOC107729772,LOC107666172,LOC107708155,LOC107554199,LOC107685799 other downstream 2670600 31953014 ~ 31962885 (+)

Expression


Co-expression Network