G117276 (slc35d1,slc35d1a,LOC108441641,LOC108272060,LOC101078039,LOC107551012)


Basic Information

Item Value
gene id G117276
gene name slc35d1,slc35d1a,LOC108441641,LOC108272060,LOC101078039,LOC107551012
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035909.1
NCBI id CM008312.1
chromosome length 44161018
location 40792755 ~ 40795804 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU158392
GTGAACTGTGCAACAAAGAGCATGTCTGACCAGCCATCATAATCCAGAGCCTTGTCTATGTCTCCCATGACGTGTGCCAAAAGCAGTGTTGGCAGGATCATAAATAAAGCATTGTAATAGAGTAGACCATATTTTCCCAGCTCCTTAGAGTCAAGCTTCTGTTTCACAAATGCCCCATTTGCAGCAGTTAAAACATCATTCAGTAAGATGAACACATACCCTTGCATGTCAAATGACAG

Function

symbol description
slc35d1a Predicted to enable antiporter activity and pyrimidine nucleotide-sugar transmembrane transporter activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi apparatus. Is expressed in Kupffer's vesicle; forerunner cell group; otic vesicle; and pharyngeal arch. Human ortholog(s) of this gene implicated in schneckenbecken dysplasia. Orthologous to human SLC35D1 (solute carrier family 35 member D1).
slc35d1 Predicted to enable antiporter activity and pyrimidine nucleotide-sugar transmembrane transporter activity. Predicted to be involved in carbohydrate transport and pyrimidine nucleotide-sugar transmembrane transport. Predicted to act upstream of or within chondroitin sulfate biosynthetic process; embryonic skeletal system development; and pyrimidine nucleotide-sugar transmembrane transport. Predicted to be located in endoplasmic reticulum. Predicted to be active in Golgi apparatus. Implicated in schneckenbecken dysplasia.

NR:

description
UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU158392 True 239 lncRNA 0.42 3 40792755 40795804

Neighbor

gene id symbol gene type direction distance location
LOC103034848 NA coding downstream 15098 40755348 ~ 40777657 (-)
uhmk1 uhmk1,LOC107692420 coding downstream 156066 40619482 ~ 40636689 (-)
LOC111193786 NA coding downstream 1509840 39271790 ~ 39282915 (-)
lnp1 lnp1 coding downstream 1767593 39013038 ~ 39025162 (-)
LOC103031712 tmem45a,LOC107685333 coding downstream 1781001 39002702 ~ 39011754 (-)
LOC103032504 ap1m3,LOC108441657,LOC107724146,LOC107684323,LOC108271949,LOC107692442,LOC106528254 coding upstream 429037 41224841 ~ 41249611 (-)
c13h1orf210 NA coding upstream 455213 41251017 ~ 41260579 (-)
orc1 orc1,LOC107725193,LOC105913168,LOC104957406 coding upstream 528918 41324722 ~ 41335529 (-)
tspan1 NA coding upstream 575232 41371036 ~ 41385641 (-)
LOC111193790 NA coding upstream 786029 41581833 ~ 41582017 (-)
G117274 NA non-coding downstream 6228 40786221 ~ 40786527 (-)
LOC111193788 NA non-coding downstream 71630 40717856 ~ 40721125 (-)
G117253 NA non-coding downstream 82963 40707782 ~ 40709792 (-)
G117240 NA non-coding downstream 138980 40653051 ~ 40653775 (-)
G117239 uap1,LOC107551035 non-coding downstream 142652 40642948 ~ 40650103 (-)
G117277 slc35d1,slc35d1a,LOC108272060,LOC108441641,LOC107758361,LOC107551012,LOC107724140 non-coding upstream 108 40795912 ~ 40797819 (-)
G117278 NA non-coding upstream 3795 40799599 ~ 40802426 (-)
G117300 NA non-coding upstream 295670 41091474 ~ 41091994 (-)
G117305 NA non-coding upstream 324948 41120752 ~ 41121048 (-)
G117357 NA non-coding upstream 508733 41304537 ~ 41307461 (-)
LOC103034527 NA other downstream 23073 40731296 ~ 40769682 (-)
LOC103040080 LOC108440156 other downstream 428795 40360319 ~ 40363960 (-)
LOC103028549 NA other downstream 1501727 39284217 ~ 39291028 (-)
LOC103032356 LOC108441420,LOC108272184,LOC107582737,LOC107726519 other downstream 1829061 38953162 ~ 38963694 (-)
negr1 negr1,LOC107673552,LOC107711106,LOC107726517,LOC107582736,LOC107585169,LOC107685309 other downstream 1893309 38630637 ~ 38899446 (-)
LOC103041916 LOC107758363,LOC107684070,LOC107692412 other upstream 20329 40816133 ~ 41017814 (-)

Expression


Co-expression Network