G117324 (ap1m3,LOC108441657,LOC108271949,LOC103463064,LOC106528254,LOC107724146,LOC103137203)


Basic Information

Item Value
gene id G117324
gene name ap1m3,LOC108441657,LOC108271949,LOC103463064,LOC106528254,LOC107724146,LOC103137203
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035909.1
NCBI id CM008312.1
chromosome length 44161018
location 41226175 ~ 41233853 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU158468
ACCGCACCCATGGTAAAGCCTGGTAGCCACTCTTCTCAATGATTTTTAGGTATCGGACCTGAATGCCAGACACAGTGAAATAAGGGATCTCAAACTTCACTGTAATCGGCCTCTTGGCTTCTTTTTCGTCGCTCTCCACACTTGGCAGCCCAAAGTGAGCTCTCATCATGTACTCTTTCCCTCCTGGGAAGGATTTGATGACCCATTCCACAGCGCTCTTCTCAGGTACCCACTTGGCATTGCCTGTGCTGGTCTTAAATCTGGGAGAGTCAGCGTCACTGGGCACAGGCACCAGAATGGACACGTTATTGGCTGTGGAGCGACTCTTAAACTGACTCCGGGCCTTAACTTTGATTTCTACTCGGCTGTGGGAAAACTTCTCAATCACGCTTTCAATCCATATAAGGGGCTTCACC

Function

symbol description
ap1m3 Predicted to enable clathrin adaptor activity. Acts upstream of or within brain development. Predicted to be located in membrane. Predicted to be part of clathrin adaptor complex. Predicted to be active in clathrin-coated vesicle. Is expressed in cerebellum; hindbrain; midbrain; midbrain hindbrain boundary; and somite.

NR:

description
PREDICTED: AP-1 complex subunit mu-1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU158468 True 416 lncRNA 0.50 4 41226175 41233853

Neighbor

gene id symbol gene type direction distance location
tmem125 tmem125,LOC108440199,LOC107725195,LOC107684333,LOC107551025 coding upstream 9908 41194102 ~ 41216267 (+)
LOC103041612 LOC108440175 coding upstream 100604 41121126 ~ 41125571 (+)
slc35d1 slc35d1,slc35d1a,LOC108441641,LOC108272060,LOC107724140,LOC107758361,LOC107684099 coding upstream 428239 40786228 ~ 40797936 (+)
LOC103042225 NA coding upstream 442974 40777645 ~ 40783201 (+)
LOC103035173 serbp1,LOC107594603,LOC107758366,LOC107692416 coding upstream 493609 40725657 ~ 40732566 (+)
tie1 tie1,LOC107731644,LOC107684058 coding downstream 48998 41282851 ~ 41305229 (+)
mpl NA coding downstream 74723 41308576 ~ 41323618 (+)
prpf38a prpf38a coding downstream 109569 41343422 ~ 41347799 (+)
pik3r3 pik3r3,LOC107692397,LOC107717145,LOC107594617,LOC106584012,LOC107556985 coding downstream 252608 41486461 ~ 41801791 (+)
gpbp1l1 gpbp1l1,LOC107731630,LOC107551044,LOC107725200 coding downstream 856136 42089989 ~ 42099620 (+)
G117299 NA non-coding upstream 134183 41091501 ~ 41091992 (+)
G117183 NA non-coding upstream 404845 40817176 ~ 40821330 (+)
G117156 NA non-coding upstream 596031 40624010 ~ 40630144 (+)
G117154 NA non-coding upstream 605409 40619568 ~ 40620766 (+)
G117152 NA non-coding upstream 645871 40567208 ~ 40580304 (+)
LOC111193789 NA non-coding downstream 71470 41305323 ~ 41306911 (+)
G117370 NA non-coding downstream 98348 41332201 ~ 41335785 (+)
G117379 NA non-coding downstream 117098 41350951 ~ 41352350 (+)
G117474 NA non-coding downstream 545098 41778951 ~ 41784207 (+)
G117396 NA non-coding downstream 568550 41802403 ~ 41873492 (+)
fam183a NA other upstream 60016 41159187 ~ 41166159 (+)
LOC103033994 LOC103033994,LOC108441647 other upstream 417630 40799471 ~ 40808545 (+)
G116997 NA other upstream 1866787 39358871 ~ 39359388 (+)
LOC103036266 LOC108441345 other upstream 2831645 38390277 ~ 38394530 (+)
gabra5 gabra5,LOC107711088,LOC107673539,LOC107585151,LOC107685289 other upstream 3613853 37524851 ~ 37612322 (+)
pomgnt1 pomgnt1,LOC102776429 other downstream 119648 41353501 ~ 41367729 (+)
G117642 NA other downstream 1117954 42351807 ~ 42355784 (+)

Expression


Co-expression Network