G60594


Basic Information

Item Value
gene id G60594
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 121524 ~ 121725 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU68968
TCTAATTTTAAATAAAAACAAAAAATATAGATGAAAAATTAGCTTAAGTAAGAAATTTACTTTTGCTATTGTTAAATAAATGTTCAGTGATATCTTCCAAAGATTTTTGAATTTTGGCACAATTGTTTCTCTATATATTGTCAATATGGCAACTAGTAAATACGCTAAGTTTCTTCATGCTAGCGTGTGTGGAAGTATTTAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU68968 True 202 lncRNA 0.25 1 121524 121725

Neighbor

gene id symbol gene type direction distance location
CI01000010_00023093_00024037 NA coding upstream 96981 20332 ~ 24543 (+)
CI01000010_00322969_00326216 DFFB coding downstream 201244 322969 ~ 327175 (+)
CI01000010_00332125_00333333 B3GNT7L coding downstream 210400 332125 ~ 333470 (+)
CI01000010_00357915_00361980 LRRC47 coding downstream 236190 357915 ~ 362086 (+)
CI01000010_00367694_00371294 MAD2L2, MAD2L2.S coding downstream 244461 366186 ~ 371422 (+)
CI01000010_00379332_00382116 NA coding downstream 257607 379332 ~ 382311 (+)
G60562 NA non-coding upstream 17360 103911 ~ 104164 (+)
G60622 NA non-coding downstream 63102 184827 ~ 192241 (+)
G60665 NA non-coding downstream 172799 294524 ~ 294762 (+)
G60700 NA non-coding downstream 174129 295854 ~ 296063 (+)
G60705 NA non-coding downstream 178845 300570 ~ 301252 (+)
G60706 NA non-coding downstream 182123 303848 ~ 304100 (+)
CI01000010_00826648_00831638 NA other downstream 699299 826648 ~ 832705 (+)
CI01000010_00881905_00883563 NA other downstream 744089 881195 ~ 883684 (+)
CI01000010_00946586_00947327 NA other downstream 823457 945182 ~ 947577 (+)
CI01000010_03197380_03199958 NA other downstream 3072430 3197380 ~ 3200044 (+)
CI01000010_03320340_03346243 NA other downstream 3191970 3313695 ~ 3347796 (+)

Expression


Co-expression Network