G60693


Basic Information

Item Value
gene id G60693
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 596824 ~ 597095 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU69087
ACATTTCCTCTCTCAAGATCCATTAATGTAGTTTGGCGGTTTGACACGCGATCCAAATCATGATTCGACACGCTGATTCATAACGCTCCGAAGCTTAATGTAGCAGTGTTTTGAAATCGGCCATCACTATATAAGTTGTTATTTTGTTTTTTTGGCGCACCAAAAATATTCTTGTCGCTTTATAATATTAATATTGAACCACTGTACTCACATGAACTGATTTAAATATGTTTTTAGTACTGATCTTGAGAGAGGAAATGTCATTGCTGGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU69087 True 272 lncRNA 0.36 1 596824 597095

Neighbor

gene id symbol gene type direction distance location
CI01000010_00588108_00595271 PDZD4 coding upstream 1362 587629 ~ 595462 (+)
CI01000010_00529313_00531098 NA coding upstream 65596 529313 ~ 531228 (+)
CI01000010_00504866_00514962 NA coding upstream 80850 504866 ~ 515974 (+)
CI01000010_00491341_00497973 NA coding upstream 98625 491297 ~ 498199 (+)
CI01000010_00473858_00478160 NA coding upstream 118402 473459 ~ 478422 (+)
CI01000010_00746445_00783522 CACNA1FB, CACNA1F coding downstream 149350 746445 ~ 783522 (+)
CI01000010_00797362_00800297 SYP, SYPA coding downstream 200267 797362 ~ 800301 (+)
CI01000010_00808732_00810151 NA coding downstream 211637 808732 ~ 810331 (+)
CI01000010_00826648_00831638 NA coding downstream 229553 826648 ~ 832705 (+)
CI01000010_00841791_00854049 UCKL1A, UCKL1B, UCKL1 coding downstream 244696 841791 ~ 854239 (+)
G60745 NA non-coding upstream 28892 567603 ~ 567932 (+)
G60667 NA non-coding upstream 45488 541818 ~ 551336 (+)
G60707 NA non-coding upstream 290432 306189 ~ 306392 (+)
G60706 NA non-coding upstream 292724 303848 ~ 304100 (+)
G60705 NA non-coding upstream 295572 300570 ~ 301252 (+)
G60780 NA non-coding downstream 75971 673066 ~ 678107 (+)
G60801 NA non-coding downstream 130742 727837 ~ 736009 (+)
G60817 NA non-coding downstream 191793 788888 ~ 789426 (+)
G60852 NA non-coding downstream 351762 948857 ~ 959047 (+)
G60915 NA non-coding downstream 421922 1019017 ~ 1019485 (+)
CI01000010_00881905_00883563 NA other downstream 268719 881195 ~ 883684 (+)
CI01000010_00946586_00947327 NA other downstream 348087 945182 ~ 947577 (+)
CI01000010_03197380_03199958 NA other downstream 2597060 3197380 ~ 3200044 (+)
CI01000010_03320340_03346243 NA other downstream 2716600 3313695 ~ 3347796 (+)

Expression


Co-expression Network