G61075


Basic Information

Item Value
gene id G61075
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 780807 ~ 783522 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU69549
CTTATAATGAGCATCATCCTCCTCTTGCTCCTCCTCCAAACCATCGTCTTCCTCCTCCAGATCTTCGTTCAAGGCCAGTCTCATTTCTGGCCCTAGGTCCTGCAGAGTTCGCAGCCCTGCCTGACACAGCTGTAGAGCTGAAGGGTTACCATTCTCTGAATCTCCCAGACCCACTTTCTCTTTCCTTTTACGGAACTTCCTGAAATAGTCCTGGATCAGGAACGTAGCATAGAATTTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU69549 True 239 lncRNA 0.49 2 780807 783522

Neighbor

gene id symbol gene type direction distance location
CI01000010_00691767_00731442 MAGIXA, MAGIX coding downstream 49365 691767 ~ 731442 (-)
CI01000010_00653231_00678240 NA coding downstream 101114 653185 ~ 679693 (-)
CI01000010_00601570_00615159 IQSEC2 coding downstream 165648 601570 ~ 615159 (-)
CI01000010_00553512_00562038 NA coding downstream 218769 553413 ~ 562038 (-)
CI01000010_00532752_00544586 CSDE1 coding downstream 236221 532617 ~ 544586 (-)
CI01000010_00810923_00813645 NA coding upstream 26925 810447 ~ 813870 (-)
CI01000010_00861290_00870510 NA coding upstream 76958 860480 ~ 871146 (-)
CI01000010_00902754_00903080 NA coding upstream 118995 902517 ~ 903230 (-)
CI01000010_00929453_00930078 NA coding upstream 145539 929061 ~ 930537 (-)
CI01000010_00952202_00958971 PTK6 coding upstream 168370 951892 ~ 959383 (-)
G61043 NA non-coding downstream 184122 596126 ~ 596685 (-)
G61055 NA non-coding downstream 195720 584816 ~ 585087 (-)
G61051 NA non-coding downstream 201041 579044 ~ 579766 (-)
G61050 NA non-coding downstream 201859 578669 ~ 578948 (-)
G61035 NA non-coding downstream 215979 564608 ~ 564828 (-)
G61098 NA non-coding upstream 5673 789195 ~ 789490 (-)
G61104 NA non-coding upstream 20673 804195 ~ 804412 (-)
G61105 NA non-coding upstream 21548 805070 ~ 805362 (-)
G61115 NA non-coding upstream 54940 838462 ~ 840123 (-)
G61117 NA non-coding upstream 57239 840761 ~ 844440 (-)
G61045 NA other downstream 205296 572753 ~ 575511 (-)
G61888 NA other upstream 460947 1244469 ~ 1246018 (-)
G61965 NA other upstream 640903 1424425 ~ 1545051 (-)
CI01000010_03527436_03530341 NA other upstream 2746148 3527408 ~ 3530359 (-)
CI01000010_03890095_03899058 SSBP3B, SSBP3, SSBP2 other upstream 3106547 3890069 ~ 3899058 (-)
G64237 NA other upstream 3446428 4229950 ~ 4236416 (-)

Expression


Co-expression Network