G61847


Basic Information

Item Value
gene id G61847
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 3439611 ~ 3439834 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU70434
GTCGATCGCAGCATATGTGCCACTTAAATGGTAGGCGGAGATGATCTGCCTCATTCAAATTGGTCCATCCTACCTTGATTAGGACCCAGTGAATAATAGATGTTTGTTGTAAACTGGGTTAAAATGTTGATAGCTGGTGAATGTAACCTAGTTTAGAGCAGTGTTCTCTCTCGCACCCATTCTTTCTATACTCCAGTGGTTAAAACAGTTTTATTAATGTTCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU70434 True 224 lncRNA 0.40 1 3439611 3439834

Neighbor

gene id symbol gene type direction distance location
CI01000010_03365131_03431309 SEMA6B coding upstream 8302 3365131 ~ 3431309 (+)
CI01000010_03320340_03346243 NA coding upstream 92807 3313695 ~ 3347796 (+)
CI01000010_03283444_03291108 ABHD17AB, ABHD17A, ABHD17AA coding upstream 147983 3283444 ~ 3291628 (+)
CI01000010_03273559_03278060 NA coding upstream 161494 3273333 ~ 3278117 (+)
CI01000010_03266931_03270717 NA coding upstream 168494 3265597 ~ 3271117 (+)
CI01000010_03455472_03466444 RORCA coding downstream 15346 3455180 ~ 3466771 (+)
CI01000010_03483057_03492616 SH3GL1B, SH3GL1 coding downstream 43223 3483057 ~ 3492894 (+)
CI01000010_03504678_03509756 NA coding downstream 64844 3504678 ~ 3509756 (+)
CI01000010_03532494_03537374 CPOX coding downstream 92660 3532494 ~ 3538010 (+)
CI01000010_03549798_03555625 TMEM47, TMEM47.L coding downstream 109964 3549798 ~ 3555809 (+)
G61835 NA non-coding upstream 166606 3272794 ~ 3273005 (+)
G61826 NA non-coding upstream 206732 3201639 ~ 3232879 (+)
G61409 NA non-coding upstream 352595 3055174 ~ 3087016 (+)
G61444 NA non-coding upstream 397129 3031757 ~ 3042482 (+)
G61860 NA non-coding downstream 131084 3570918 ~ 3571148 (+)
G61879 NA non-coding downstream 245602 3685436 ~ 3685759 (+)
G62738 NA non-coding downstream 264155 3703989 ~ 3704201 (+)
G62748 NA non-coding downstream 317366 3757200 ~ 3757801 (+)
CI01000010_03781620_03785840 GM11353, RPS8B, RPS8 non-coding downstream 341799 3781620 ~ 3786254 (+)
CI01000010_03197380_03199958 NA other upstream 239703 3197380 ~ 3200044 (+)
CI01000010_00946586_00947327 NA other upstream 2492067 945182 ~ 947577 (+)
CI01000010_00881905_00883563 NA other upstream 2556097 881195 ~ 883684 (+)
CI01000010_00826648_00831638 NA other upstream 2601179 826648 ~ 832705 (+)
G62838 NA other downstream 450261 3890095 ~ 3893793 (+)
G62856 NA other downstream 497923 3937757 ~ 3939945 (+)
G62983 NA other downstream 1008338 4448172 ~ 4449327 (+)
CI01000010_04640858_04683752 OSBPL9 other downstream 1201007 4640516 ~ 4683778 (+)
G63403 NA other downstream 2255611 5695445 ~ 5707085 (+)

Expression


Co-expression Network