G61879


Basic Information

Item Value
gene id G61879
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 3685436 ~ 3685759 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU70473
CTTCAATTATTGCTTTGTAATCATTCAAACAGTGACGCATTACTTAAACACTATTTTACAATAGTGTAAATATATGCGTATTATGGCTTTCCGTATGCAAGCTGTGTATTGTTCAAAAAGTGATAATACAATATTCTGAACAGTTTTAAAGGTGTTTGATATGTTTAGCTTGAATTACTGAAAACATCTATCTATCTATCTATCTATCGTTCTATCTATCGTTCTGTCTATGAATGAATGTAAGATGTAGAACAGGTTATTGCAGTATATTGTTTTTTCTTTTTTCTTTTTTGGTGTTAATAAAATTATATGCCACCACTCTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU70473 True 324 lncRNA 0.29 1 3685436 3685759

Neighbor

gene id symbol gene type direction distance location
CI01000010_03637767_03674123 NA coding upstream 11269 3637767 ~ 3674167 (+)
CI01000010_03625058_03633146 NA coding upstream 52236 3625025 ~ 3633200 (+)
CI01000010_03591507_03597612 NA coding upstream 87239 3591507 ~ 3598197 (+)
CI01000010_03577980_03589314 NEXN coding upstream 96088 3577980 ~ 3589348 (+)
CI01000010_03549798_03555625 TMEM47, TMEM47.L coding upstream 129627 3549798 ~ 3555809 (+)
CI01000010_03721429_03756576 RNF220B coding downstream 35670 3721429 ~ 3756576 (+)
CI01000010_03761210_03764319 GUK1B coding downstream 75451 3761210 ~ 3764877 (+)
CI01000010_03764993_03769503 NA coding downstream 79234 3764993 ~ 3769503 (+)
CI01000010_03770735_03776382 NA coding downstream 84976 3770735 ~ 3776567 (+)
CI01000010_03778292_03781230 ELOVL8B coding downstream 92533 3778292 ~ 3781440 (+)
G61860 NA non-coding upstream 114288 3570918 ~ 3571148 (+)
G61847 NA non-coding upstream 245602 3439611 ~ 3439834 (+)
CI01000010_03320340_03346243 NA non-coding upstream 337640 3313695 ~ 3347796 (+)
G61835 NA non-coding upstream 412431 3272794 ~ 3273005 (+)
G61826 NA non-coding upstream 452557 3201639 ~ 3232879 (+)
G62738 NA non-coding downstream 18230 3703989 ~ 3704201 (+)
G62748 NA non-coding downstream 71441 3757200 ~ 3757801 (+)
CI01000010_03781620_03785840 GM11353, RPS8B, RPS8 non-coding downstream 95874 3781620 ~ 3786254 (+)
G62791 NA non-coding downstream 130272 3816031 ~ 3816505 (+)
G62788 NA non-coding downstream 132897 3818656 ~ 3846441 (+)
CI01000010_03197380_03199958 NA other upstream 485528 3197380 ~ 3200044 (+)
CI01000010_00946586_00947327 NA other upstream 2737892 945182 ~ 947577 (+)
CI01000010_00881905_00883563 NA other upstream 2801922 881195 ~ 883684 (+)
CI01000010_00826648_00831638 NA other upstream 2847004 826648 ~ 832705 (+)
G62838 NA other downstream 204336 3890095 ~ 3893793 (+)
G62856 NA other downstream 251998 3937757 ~ 3939945 (+)
G62983 NA other downstream 762413 4448172 ~ 4449327 (+)
CI01000010_04640858_04683752 OSBPL9 other downstream 955082 4640516 ~ 4683778 (+)
G63403 NA other downstream 2009686 5695445 ~ 5707085 (+)

Expression


Co-expression Network