G62930


Basic Information

Item Value
gene id G62930
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 4305065 ~ 4305265 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU71679
ACAAACACTTACTACACACACTCATTTGCTTAGCAATCTAAATTATTACCTATAAAAGACTTACATGTTTTTACACTAAACTAATTATAAGTACTAATAACTATTACCCAAACACTAAATGGAGGTTTTGTCATATTTAGCTAACTTCTGGAGACAAATTTGTCCCCAAAGTATATCTAAGTAAACCATGACTGCACTTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU71679 True 201 lncRNA 0.30 1 4305065 4305265

Neighbor

gene id symbol gene type direction distance location
CI01000010_04165584_04232583 SKIA, SKI coding upstream 72482 4165584 ~ 4232583 (+)
CI01000010_04046204_04137642 PRKCZ coding upstream 167423 4046204 ~ 4137642 (+)
CI01000010_04025764_04026729 NA coding upstream 277799 4025361 ~ 4027266 (+)
CI01000010_04010515_04020837 ST6GALNAC5B coding upstream 284167 4010515 ~ 4020898 (+)
CI01000010_03952874_03957173 NA coding upstream 347821 3952874 ~ 3957244 (+)
CI01000010_04368541_04374080 NA coding downstream 63206 4368471 ~ 4374174 (+)
CI01000010_04377762_04378990 MRPS36 coding downstream 71882 4377147 ~ 4379082 (+)
CI01000010_04437892_04443935 RAB3C coding downstream 132164 4437429 ~ 4444446 (+)
CI01000010_04534309_04549864 NA coding downstream 228913 4534178 ~ 4549959 (+)
CI01000010_04609294_04611679 NDUFAF2 coding downstream 303924 4609189 ~ 4611710 (+)
G62926 NA non-coding upstream 5143 4299693 ~ 4299922 (+)
G62925 NA non-coding upstream 7438 4297361 ~ 4297627 (+)
G62923 NA non-coding upstream 13754 4291085 ~ 4291311 (+)
G62895 NA non-coding upstream 209678 4092045 ~ 4095387 (+)
G62893 NA non-coding upstream 243875 4054595 ~ 4061190 (+)
G62934 NA non-coding downstream 1656 4306921 ~ 4326352 (+)
G62947 NA non-coding downstream 21224 4326489 ~ 4326710 (+)
G62948 NA non-coding downstream 24493 4329758 ~ 4329998 (+)
G62980 NA non-coding downstream 89715 4394980 ~ 4482134 (+)
G62982 NA non-coding downstream 140251 4445516 ~ 4447186 (+)
G62856 NA other upstream 365120 3937757 ~ 3939945 (+)
G62838 NA other upstream 411272 3890095 ~ 3893793 (+)
CI01000010_03320340_03346243 NA other upstream 973879 3313695 ~ 3347796 (+)
CI01000010_03197380_03199958 NA other upstream 1105157 3197380 ~ 3200044 (+)
CI01000010_00946586_00947327 NA other upstream 3357521 945182 ~ 947577 (+)
G62983 NA other downstream 142907 4448172 ~ 4449327 (+)
CI01000010_04640858_04683752 OSBPL9 other downstream 335576 4640516 ~ 4683778 (+)
G63403 NA other downstream 1390180 5695445 ~ 5707085 (+)
G63405 NA other downstream 1402706 5707971 ~ 5717250 (+)
CI01000010_05789479_05790006 NA other downstream 1451688 5788332 ~ 5790204 (+)

Expression


Co-expression Network