G198378 (thsd7a,LOC108410784,LOC104968073,LOC103477695)


Basic Information

Item Value
gene id G198378
gene name thsd7a,LOC108410784,LOC104968073,LOC103477695
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035919.1
NCBI id CM008322.1
chromosome length 38085671
location 18651980 ~ 18652794 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU269346
TAACTTTCCTGGTCTGCACACCCTCCCCACAGTTCTCCTTCAAGTCCACATTGCTGACTTTCCACACACTCCAAGGTTCAGCCAGCCAGACATACTGACCGCAGTCACTCTGACATGGTACAACCTCATACACCTGCACCTGATTAACGTGGTCCAGTTTTGGGCATGGGCGTCCGCCATTGTAGGGCTTCTCCCTGAGCCATTTTGACCGCACTTTGACGCCACTACCGCAGGACTTGCTGCAGCGTGACCAGTTGGACCACTCGCTGAGTTTGCAATCGGAGGGGCAGGGAATGATGCAAGCTTCTTCAATGTAAC

Function

symbol description
thsd7a Predicted to be involved in actin cytoskeleton reorganization. Located in plasma membrane.

NR:

description
PREDICTED: thrombospondin type-1 domain-containing protein 7A-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU269346 True 318 lncRNA 0.53 2 18651980 18652794

Neighbor

gene id symbol gene type direction distance location
smap2 smap2 coding upstream 524459 18103816 ~ 18127521 (+)
col16a1 col16a1 coding upstream 589113 17934693 ~ 18062867 (+)
adgrb2 adgrb2,LOC107722142 coding upstream 822103 17294891 ~ 17829877 (+)
med10 med10,LOC107595625,LOC107691542,LOC106588698 coding upstream 1950733 16695596 ~ 16701247 (+)
nsun2 nsun2,LOC107694333,LOC107691499,LOC107711338 coding upstream 2018528 16599287 ~ 16633452 (+)
LOC103029482 LOC103029482 coding downstream 197733 18850527 ~ 18851285 (+)
pip4p2 tmem55a,LOC107724355,LOC107696196,LOC107702130 coding downstream 253792 18906586 ~ 18924321 (+)
tmem64 tmem64,LOC107696193,LOC107584320 coding downstream 346580 18999374 ~ 19011467 (+)
bag6 bag6,bag6l coding downstream 395146 19047940 ~ 19067708 (+)
abcf1 abcf1,LOC107745711 coding downstream 426291 19079085 ~ 19100818 (+)
LOC111195524 NA non-coding upstream 29069 18610759 ~ 18622911 (+)
G198374 NA non-coding upstream 41895 18609564 ~ 18610085 (+)
G198368 NA non-coding upstream 51355 18600405 ~ 18600625 (+)
G198362 NA non-coding upstream 73690 18575228 ~ 18578290 (+)
G198356 LOC108410782,LOC107698976,LOC107670023,LOC107555956,LOC107722163 non-coding upstream 115309 18493617 ~ 18536671 (+)
G198468 NA non-coding downstream 420006 19072800 ~ 19073616 (+)
G198537 NA non-coding downstream 559201 19211995 ~ 19212328 (+)
G198584 NA non-coding downstream 818565 19471359 ~ 19471750 (+)
G198588 NA non-coding downstream 834146 19486940 ~ 19490316 (+)
G198603 NA non-coding downstream 1029907 19682701 ~ 19719993 (+)
G198344 NA other upstream 266908 18384627 ~ 18385072 (+)
LOC111195522 LOC107679107,LOC107679108 other upstream 2221446 16424617 ~ 16430534 (+)
c23h5orf49 cunh5orf49,LOC103039620 other upstream 2258482 16388808 ~ 16393498 (+)
atat1 atat1 other upstream 2292312 16345117 ~ 16359668 (+)
ppp1r11 ppp1r11,LOC107694341 other upstream 2321740 16321942 ~ 16330240 (+)
G198397 NA other downstream 205738 18858532 ~ 18863366 (+)
G198400 NA other downstream 234675 18887469 ~ 18891614 (+)
ppp1r10 ppp1r10,LOC107745712,LOC107687078,LOC107691520,LOC107709274 other downstream 451613 19104407 ~ 19116302 (+)
LOC103045134 khdrbs1,LOC103045134,LOC107691518,LOC101482948,LOC102791371,LOC107709277,LOC107584277 other downstream 513552 19166346 ~ 19182478 (+)
G198535 NA other downstream 552283 19205077 ~ 19205658 (+)

Expression


Co-expression Network