G63149



Basic Information


Item Value
gene id G63149
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 4946465 ~ 4946668 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU71938
CGCAGACATTAATCACAACTATTGCTGTATAAAAGTGTCTTGACTTCCGTTATTCATTTACCCCTGTGGGCTGTACTATGAACAGGACAGTTTGAGAGTCGCACCTATTAGTAAATGTCAATTCCAAACTCTGTCTGTGTGAACACAGCCATAGAACCTTCATTAAGTGGAGGAAAGTTTGATGTTGAATGTCTTAGATGTAGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU71938 True 204 lncRNA 0.40 1 4946465 4946668
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000010_04871254_04873119 DMRTA2, DMRT5 coding upstream 72547 4870540 ~ 4873918 (+)
CI01000010_04803003_04849985 FAF1 coding upstream 96480 4803003 ~ 4849985 (+)
CI01000010_04753467_04770912 RNF11L2, RNF11B, RNF11 coding upstream 174791 4753231 ~ 4771674 (+)
CI01000010_04735645_04749008 TTC39A coding upstream 197241 4735645 ~ 4749224 (+)
CI01000010_04696294_04717129 EPS15 coding upstream 229243 4696294 ~ 4717222 (+)
CI01000010_05012978_05018219 NA coding downstream 64711 5011379 ~ 5018346 (+)
CI01000010_05047527_05065421 NA coding downstream 100859 5047527 ~ 5066870 (+)
CI01000010_05185530_05200227 NA coding downstream 238453 5185121 ~ 5200514 (+)
CI01000010_05238328_05242974 NA coding downstream 290361 5237029 ~ 5243396 (+)
CI01000010_05308426_05318353 BEND5 coding downstream 361624 5308292 ~ 5319096 (+)
G63134 NA non-coding upstream 44823 4901433 ~ 4901642 (+)
G63131 NA non-coding upstream 66944 4879024 ~ 4879521 (+)
G63096 NA non-coding upstream 172766 4772221 ~ 4773699 (+)
G63058 NA non-coding upstream 355326 4590169 ~ 4591139 (+)
G63078 NA non-coding upstream 373971 4572277 ~ 4572494 (+)
G63151 NA non-coding downstream 6874 4953542 ~ 4953763 (+)
CI01000010_04934550_04955403 NA non-coding downstream 8575 4933856 ~ 4956630 (+)
G63162 NA non-coding downstream 36948 4983616 ~ 4992490 (+)
G63359 NA non-coding downstream 623503 5570171 ~ 5579186 (+)
CI01000010_04640858_04683752 OSBPL9 other upstream 292472 4640516 ~ 4683778 (+)
G62983 NA other upstream 497138 4448172 ~ 4449327 (+)
G62856 NA other upstream 1006520 3937757 ~ 3939945 (+)
G62838 NA other upstream 1052672 3890095 ~ 3893793 (+)
CI01000010_03320340_03346243 NA other upstream 1615279 3313695 ~ 3347796 (+)
G63403 NA other downstream 748777 5695445 ~ 5707085 (+)
G63405 NA other downstream 761303 5707971 ~ 5717250 (+)
CI01000010_05789479_05790006 NA other downstream 810285 5788332 ~ 5790204 (+)
G63524 NA other downstream 1427890 6374558 ~ 6374667 (+)
G63572 NA other downstream 1639260 6585928 ~ 6617806 (+)

Expression


G63149 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G63149 Expression in each Bioproject

Bar chart with 3 bars.
G63149 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network