G201167


Basic Information

Item Value
gene id G201167
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035919.1
NCBI id CM008322.1
chromosome length 38085671
location 31548349 ~ 31631753 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU273192
tagggctggcccgaatagcgttttttgagctccggatattcggcactgattcgaagcgaatattcgaatattcgtttttaaaaaaagagataaaaaaaagcaaatcacggcccctttaatccactgaaaaatgttcaatttgctctgaccgacgagacatattcaccccggatttttggtgtttttatcccccatatttttgtgttttcaccccatattttt

Function

GO: NA

KEGG:

id description
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko00982 Drug metabolism - cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU273192 True 222 lncRNA 0.39 2 31548349 31631753

Neighbor

gene id symbol gene type direction distance location
trnaq-cug_20 NA coding upstream 116374 31431904 ~ 31431975 (+)
trnaq-cug_19 NA coding upstream 116707 31431571 ~ 31431642 (+)
trnaq-cug_18 NA coding upstream 117037 31431241 ~ 31431312 (+)
trnar-acg_20 NA coding upstream 117326 31430951 ~ 31431023 (+)
trnaq-uug_6 NA coding upstream 117731 31430547 ~ 31430618 (+)
LOC103047171 ext1,ext1c,LOC107592945,LOC107706241,LOC107654729,LOC107688378,LOC107754264 coding downstream 439892 32071645 ~ 32180536 (+)
ncdn NA coding downstream 555404 32187157 ~ 32193783 (+)
tfap2e tfap2e coding downstream 564462 32196215 ~ 32211930 (+)
LOC103044735 LOC108430542,LOC107591984,LOC108257069,LOC107654683,LOC107592950,LOC107754258 coding downstream 660426 32292179 ~ 32295555 (+)
cdca8 cdca8 coding downstream 668621 32300374 ~ 32304369 (+)
G201163 NA non-coding upstream 96593 31441445 ~ 31451756 (+)
G201135 NA non-coding upstream 285389 31259945 ~ 31262960 (+)
G201019 nup153,LOC107706220 non-coding upstream 518460 31018604 ~ 31029889 (+)
G201030 NA non-coding upstream 542424 31005632 ~ 31005925 (+)
G201010 NA non-coding upstream 738123 30809995 ~ 30810226 (+)
G201206 NA non-coding downstream 307748 31939501 ~ 31939940 (+)
G201225 NA non-coding downstream 381325 32013078 ~ 32065707 (+)
G201281 LOC108430540,LOC102218321,LOC103154989,LOC108257141,LOC103371078,LOC103461361 non-coding downstream 549942 32181695 ~ 32186335 (+)
G201289 psmb2,LOC107591978,LOC107592948,LOC107688376 non-coding downstream 585381 32217134 ~ 32228952 (+)
G201287 NA non-coding downstream 622736 32254489 ~ 32260203 (+)
rbm24 rbm24,rbm24a,LOC107754275,LOC107592929 other upstream 463716 31009926 ~ 31084633 (+)
G201018 NA other upstream 533304 31012711 ~ 31015045 (+)
lypla2 lypla2,lypa2 other upstream 1980274 29528063 ~ 29568075 (+)
eloa tceb3 other upstream 1995465 29542748 ~ 29552884 (+)
G200341 LOC108426039 other upstream 3352151 28193574 ~ 28196198 (+)
G201207 NA other downstream 310449 31942202 ~ 31987057 (+)
tpmt tpmt other downstream 421962 32053715 ~ 32067640 (+)
LOC103043810 ago4,LOC106511154,LOC103043810 other downstream 637545 32269298 ~ 32287803 (+)
G201445 flii,LOC107581766,LOC107737969,LOC107703428,LOC107674686 other downstream 1291775 32923528 ~ 32927919 (+)
bud31 bud31,LOC107737741,LOC107720055 other downstream 1342567 32974320 ~ 32977910 (+)

Expression


Co-expression Network