G201708


Basic Information

Item Value
gene id G201708
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035919.1
NCBI id CM008322.1
chromosome length 38085671
location 33704346 ~ 33704880 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU273902
actttacttggatggtccattttatagccttgttgatgctcagctgacattcaactaacactgaattgaatgtccattaaatttaacttaaccctatgttgaatgtaaatgattcaaaatagaacctaaccctacacctaaccctaacattaacccttaatcaaccataaaatctaaccctacacttaaccctaaccttaacccttaatcaactataaaatctaaccctacacctaaccttaacccttaatcaaccctaaaatctaaccctacacctaaccctaaccttaacccttaatcaactataaaatctaaccctacacctaaccctaaccttaacc

Function

GO:

id name namespace
GO:0022604 regulation of cell morphogenesis biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU273902 True 341 lncRNA 0.35 2 33704346 33704880

Neighbor

gene id symbol gene type direction distance location
LOC103025781 fscn1,fscn1a,LOC107581720,LOC107742378,LOC107674660,LOC107720060 coding upstream 355678 33334726 ~ 33348668 (+)
tnrc18 tnrc18 coding upstream 485510 33099446 ~ 33218836 (+)
slc29a4 slc29a4,LOC108430547,LOC107720057,LOC107581724,LOC107737679,LOC107703421 coding upstream 671624 33006117 ~ 33032722 (+)
cpsf4 cpsf4 coding upstream 718979 32978956 ~ 32985367 (+)
smcr8 smcr8 coding upstream 746712 32948181 ~ 32957634 (+)
tmem184a tmem184a,LOC107581701,LOC107745595,LOC107674661 coding downstream 112651 33817531 ~ 33884645 (+)
ints1 ints1,LOC107703394,LOC107572041 coding downstream 234554 33939434 ~ 33998741 (+)
LOC103027444 NA coding downstream 310822 34015702 ~ 34024202 (+)
micall2 micall2,micall2a coding downstream 329620 34034500 ~ 34076513 (+)
LOC103025280 LOC108430595,LOC108256942,LOC105899944 coding downstream 501972 34206852 ~ 34244019 (+)
G201704 NA non-coding upstream 34055 33670082 ~ 33670291 (+)
G201699 NA non-coding upstream 45755 33658345 ~ 33658591 (+)
G201696 NA non-coding upstream 93995 33609896 ~ 33610351 (+)
G201694 NA non-coding upstream 97565 33606390 ~ 33606781 (+)
G201670 NA non-coding upstream 140170 33563962 ~ 33564176 (+)
G201722 NA non-coding downstream 111221 33816101 ~ 33907478 (+)
G201725 NA non-coding downstream 166969 33871849 ~ 33872537 (+)
G201786 NA non-coding downstream 319442 34024322 ~ 34025453 (+)
G201800 NA non-coding downstream 373661 34078541 ~ 34078751 (+)
G201805 LOC107720062,LOC107581717,LOC107591759,LOC107674676 non-coding downstream 456565 34161445 ~ 34194241 (+)
G201466 LOC102799139,LOC107581721 other upstream 429439 33260173 ~ 33274907 (+)
bud31 bud31,LOC107737741,LOC107720055 other upstream 726436 32974320 ~ 32977910 (+)
G201445 flii,LOC107581766,LOC107737969,LOC107703428,LOC107674686 other upstream 776427 32923528 ~ 32927919 (+)
LOC103043810 ago4,LOC106511154,LOC103043810 other upstream 1416543 32269298 ~ 32287803 (+)
tpmt tpmt other upstream 1636706 32053715 ~ 32067640 (+)
psmg3 psmg3 other downstream 106552 33811432 ~ 33814986 (+)
LOC111195488 NA other downstream 1401158 35106038 ~ 35124618 (+)
G202336 NA other downstream 2884568 36589448 ~ 36940279 (+)
LOC103041887 NA other downstream 3278443 36983323 ~ 36993332 (+)

Expression


Co-expression Network