G63390


Basic Information

Item Value
gene id G63390
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000010
NCBI id null
chromosome length 12265998
location 5659219 ~ 5659439 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU72194
CTTTTATCTTTTCTTGTTCTCTCTCTCTCAGTGCAGTACTAGCTTCAACCCTGGGACTCCCAGGTTGATGAAAAGGTATTCGCTGAGTAACTGCTACGGGTTGTGTTTGCATTGGTGTCGGTCGACTAGTCGCTCTGAATTCTTTATTCTTCTCTTTTGACTTTACTTTTCTGACTGAGGTGCTGCTGGTGCTGGTTTCCATTACGCTAGACAGGTTTTGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU72194 True 221 lncRNA 0.44 1 5659219 5659439

Neighbor

gene id symbol gene type direction distance location
CI01000010_05523602_05535371 BCAR3 coding upstream 123527 5523516 ~ 5535692 (+)
CI01000010_05494740_05504597 NA coding upstream 153958 5493967 ~ 5505261 (+)
CI01000010_05477048_05482911 NA coding upstream 175918 5476525 ~ 5483301 (+)
CI01000010_05414058_05426498 NA coding upstream 232532 5414058 ~ 5426687 (+)
CI01000010_05359191_05385419 NA coding upstream 273535 5359191 ~ 5385684 (+)
CI01000010_05789479_05790006 NA coding downstream 128893 5788332 ~ 5790204 (+)
CI01000010_05819188_05855120 CEP350 coding downstream 159749 5819188 ~ 5855163 (+)
CI01000010_05859214_05887437 NA coding downstream 199775 5859214 ~ 5888267 (+)
CI01000010_05902969_05911426 LHX4 coding downstream 243530 5902969 ~ 5912165 (+)
CI01000010_06014142_06037829 XPR1A coding downstream 354703 6014142 ~ 6038450 (+)
G63386 NA non-coding upstream 13422 5644656 ~ 5645797 (+)
G63384 NA non-coding upstream 16142 5642877 ~ 5643077 (+)
G63332 NA non-coding upstream 20987 5634187 ~ 5638232 (+)
G63328 NA non-coding upstream 67367 5591376 ~ 5591852 (+)
G63359 NA non-coding upstream 80033 5570171 ~ 5579186 (+)
G63399 NA non-coding downstream 31996 5691435 ~ 5694008 (+)
G63403 NA non-coding downstream 36006 5695445 ~ 5707085 (+)
G63405 NA non-coding downstream 56277 5707971 ~ 5717250 (+)
G63442 NA non-coding downstream 221756 5881195 ~ 5881600 (+)
G63443 NA non-coding downstream 223329 5882768 ~ 5883651 (+)
CI01000010_04640858_04683752 OSBPL9 other upstream 1005226 4640516 ~ 4683778 (+)
G62983 NA other upstream 1209892 4448172 ~ 4449327 (+)
G62856 NA other upstream 1719274 3937757 ~ 3939945 (+)
G62838 NA other upstream 1765426 3890095 ~ 3893793 (+)
CI01000010_03320340_03346243 NA other upstream 2328033 3313695 ~ 3347796 (+)
G63524 NA other downstream 715119 6374558 ~ 6374667 (+)
G63572 NA other downstream 926489 6585928 ~ 6617806 (+)

Expression


Co-expression Network