G202509


Basic Information

Item Value
gene id G202509
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035919.1
NCBI id CM008322.1
chromosome length 38085671
location 37325514 ~ 37325815 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU274900
aggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttatggttgattaagggttaaggttagggttaggtgtagggtttgattttatggttgattaagggttaaggttagggttaggtgtagggtttgattttatggttgattaagggttaaggttagggttaggtgtagggtt

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0009611 response to wounding biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0050817 coagulation biological_process
GO:0042060 wound healing biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU274900 True 204 lncRNA 0.39 2 37325514 37325815

Neighbor

gene id symbol gene type direction distance location
nsmce1 nsmce1 coding upstream 228646 37088201 ~ 37096868 (+)
LOC103045472 LOC108433148,LOC107727127,LOC107674682,LOC107745580,LOC799265,LOC105013234,LOC106607346 coding upstream 299989 37010695 ~ 37025525 (+)
zc3h7a zc3h7a coding upstream 351662 36951907 ~ 36973852 (+)
trnat-cgu_1 NA coding upstream 447620 36877823 ~ 36877894 (+)
LOC103040671 galr2b,LOC103040671,LOC108433115,LOC107674614,LOC107753547,LOC107564701,LOC107703387 coding upstream 647592 36651834 ~ 36677922 (+)
LOC103021790 LOC103021790,LOC108433116,LOC103481129 coding downstream 681706 38007521 ~ 38058413 (+)
G202492 NA non-coding upstream 29890 37233071 ~ 37295624 (+)
G202490 NA non-coding upstream 97378 37227863 ~ 37228136 (+)
G202486 NA non-coding upstream 171165 37154106 ~ 37154349 (+)
G202483 NA non-coding upstream 190531 37134726 ~ 37134983 (+)
G202406 NA non-coding upstream 262328 37061255 ~ 37063186 (+)
G202514 NA non-coding downstream 50346 37376161 ~ 37376382 (+)
G202515 NA non-coding downstream 55681 37381496 ~ 37434186 (+)
G202534 NA non-coding downstream 111553 37437368 ~ 37437780 (+)
G202538 NA non-coding downstream 129574 37455389 ~ 37455703 (+)
G202539 NA non-coding downstream 138912 37464727 ~ 37464967 (+)
LOC103041887 NA other upstream 332182 36983323 ~ 36993332 (+)
G202336 NA other upstream 385235 36589448 ~ 36940279 (+)
LOC111195488 NA other upstream 2200896 35106038 ~ 35124618 (+)
psmg3 psmg3 other upstream 3510528 33811432 ~ 33814986 (+)
G201466 LOC102799139,LOC107581721 other upstream 4050607 33260173 ~ 33274907 (+)

Expression


Co-expression Network