G312957



Basic Information


Item Value
gene id G312957
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NW_019172864.1
NCBI id APWO02000064.1
chromosome length 1192473
location 422598 ~ 436878 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>TU430814
aaaccaccaaactgaactgcttgaatttttgcaccaggagtgtaaagcataaagttatccaaaagcagtgtgtaagactggtggaggggagagaacatgatgccaagatgcatgaaaaaaaactgtgattaaaaaccaccagggttattccaccaaatattgatttctgaactcttaaaactttatgaatatgaacttgttttctttgcattatttgaggtctgaaagctctgcatctttttctcattttctgcaaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU430814 True 258 lncRNA 0.36 2 422598 436878
Loading

Neighbor


gene id symbol gene type direction distance location
LOC103046225 nr1d2,LOC107688200 coding downstream 388601 19164 ~ 33997 (-)
trip13 trip13,LOC107736543 coding upstream 457335 894213 ~ 913173 (-)
LOC103030810 NA coding upstream 590177 1027055 ~ 1074050 (-)
LOC111191426 NA coding upstream 665107 1101985 ~ 1107354 (-)
LOC111191427 NA coding upstream 670311 1107189 ~ 1135701 (-)
LOC111191429 NA coding upstream 700011 1136889 ~ 1138952 (-)
G312954 NA non-coding downstream 136784 282299 ~ 285814 (-)
G312943 NA non-coding downstream 276198 139617 ~ 146400 (-)
G312958 NA non-coding upstream 28676 465554 ~ 466966 (-)
G312964 NA non-coding upstream 54952 491830 ~ 546758 (-)
G312975 NA non-coding upstream 179527 616405 ~ 621612 (-)
G312976 NA non-coding upstream 186959 623837 ~ 624293 (-)
G313102 LOC103026354,LOC107659084,LOC107677662,LOC107601978,LOC108256542 non-coding upstream 323107 759985 ~ 765626 (-)
ubr5 ubr5,LOC107677650,LOC107659085 other upstream 341375 778253 ~ 863755 (-)
azin1 azin1 other upstream 497594 934472 ~ 958236 (-)
G313121 atp6v1c1,atp6v1c1a,LOC102305030,LOC102207943,LOC100703061 other upstream 531378 968256 ~ 986332 (-)
G313122 NA other upstream 590225 1027103 ~ 1160614 (-)
G313124 NA other upstream 680851 1117729 ~ 1153331 (-)

Expression


G312957 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G312957 Expression in each Bioproject

Bar chart with 6 bars.
G312957 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network