G2543 (samsn1)


Basic Information

Item Value
gene id G2543
gene name samsn1
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035897.1
NCBI id CM008300.1
chromosome length 26953843
location 9771436 ~ 9772691 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU3358
GGTCAGTATAAATAAAGCAGATGGAACGCCGACCTTGAGTTTAAGGGAGTCCGTGTCGTATGGACTTGGCACAAAGTCCGTGTGCACCTTGGCTCGTCCGCAGAACTGGCCGGCGTAGGGCACCTCCTCCTCCAGCCTCAGGCTGTCCCTGTTACTGGACACGTCTGAACTGCTGGTCACTCCACCTGAACTGGAAGAGCTCTGTCCACTCTGGAGGCTTTCTAATGAATTGCTGGTTCTGTGGGATGCTTTGGTTGCTGGGTTGCTGGTCTCTGCTTTGGCCTCCGCTTCTCTGTCTGTGTCATCACCC

Function

symbol description
samsn1 Enables phosphotyrosine residue binding activity. Predicted to be involved in negative regulation of B cell activation; negative regulation of adaptive immune response; and negative regulation of peptidyl-tyrosine phosphorylation. Located in nucleus.

NR:

description
PREDICTED: SAM domain-containing protein SAMSN-1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU3358 True 310 lncRNA 0.42 2 9771436 9772691

Neighbor

gene id symbol gene type direction distance location
LOC111192769 NA coding upstream 12250 9756836 ~ 9759186 (+)
LOC103038783 LOC108432999,LOC108278263,LOC106613073,LOC107589733,LOC107714181,LOC106581277,LOC105901427,LOC107666202 coding upstream 170604 9572520 ~ 9600832 (+)
LOC103045140 wscd1,LOC108432998,LOC107756514,LOC107682602,LOC107666180 coding upstream 307851 9408099 ~ 9463585 (+)
LOC103038411 NA coding upstream 615196 9154389 ~ 9156240 (+)
LOC111192952 NA coding upstream 831026 8939639 ~ 8940410 (+)
LOC103041157 NA coding downstream 136861 9909552 ~ 9971315 (+)
LOC103041662 NA coding downstream 218882 9991573 ~ 10006311 (+)
LOC103042389 LOC108444298 coding downstream 401590 10174281 ~ 10192344 (+)
LOC103043114 NA coding downstream 454079 10226770 ~ 10239820 (+)
LOC103043417 NA coding downstream 713795 10486486 ~ 10499361 (+)
G2539 NA non-coding upstream 5491 9765085 ~ 9765945 (+)
G2513 hspa13,LOC107682527,LOC107589748 non-coding upstream 19305 9751459 ~ 9752131 (+)
G2491 NA non-coding upstream 265459 9505710 ~ 9505977 (+)
G2485 NA non-coding upstream 279804 9491380 ~ 9491632 (+)
G2484 NA non-coding upstream 280138 9490620 ~ 9491298 (+)
G2547 NA non-coding downstream 8802 9781493 ~ 9782062 (+)
G2554 NA non-coding downstream 34519 9807210 ~ 9819840 (+)
G2559 NA non-coding downstream 74311 9847002 ~ 9847841 (+)
G2560 NA non-coding downstream 81241 9853932 ~ 9854164 (+)
G2561 NA non-coding downstream 82048 9854739 ~ 9855859 (+)
LOC103039705 gdpd5b,gdpd5,LOC103039705,LOC108433002,LOC108277648,LOC107666190,LOC107682503 other upstream 27945 9634093 ~ 9743491 (+)
G2509 NA other upstream 101311 9631865 ~ 9670125 (+)
lyrm9 lyrm9,LOC102789908 other upstream 814044 8944461 ~ 8957392 (+)
G2358 LOC108432992,LOC101077340,LOC100691215,LOC101465674 other upstream 1036484 8732723 ~ 8734952 (+)
G2304 NA other upstream 1210958 8560066 ~ 8560478 (+)
LOC103029949 slc46a1 other downstream 1485755 11258446 ~ 11279177 (+)
G2910 sarm1,LOC107756984 other downstream 1515440 11288131 ~ 11288846 (+)
meox2 meox2,LOC103024054,LOC107683451,LOC107730826,LOC107582293,LOC107588208,LOC107704718 other downstream 1632852 11405543 ~ 11424451 (+)
G3096 NA other downstream 2151759 11924450 ~ 11927250 (+)
G3313 sept5b,LOC108425237 other downstream 3209934 12982625 ~ 12984269 (+)

Expression


Co-expression Network