G3205


Basic Information

Item Value
gene id G3205
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035897.1
NCBI id CM008300.1
chromosome length 26953843
location 12577080 ~ 12658307 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU4203
cactccgtgcagcgttatacagagtttcagtgctatacagagtccagagccgtgcagctccgaggctggagcagcaaatagcattagctagcttattcactgttcagagatcagtattatctaaattttacccgtcaggtgtaaggagcagtaaacacacactccgtgcagagccgtgccgctccgaggctggagcagcaatagctagatgctaaccgcttagctagctagctttttcactgttcagagatcagtattttctaaatttagtacttttaatactgctggagcagtattattagagttagatgctaatcgctaagcgttcaccgttcagaggtgagttatcggcctgtaagtctgtgctgctttgcctggctagcattagctagatgctaagcgctaactctctcagaggtgagttttatcagcctgtaatctgcttgtttaccgtgttaaaacaagctacgggggacgaatcgctagctaatatctcactgtcttaccagaacacgcaggattactcagtgtaacgctgtcgtttaagtttgggttaactttactagtttaggtgactagctagcgtgctagcggatagctatgctaacgctggtgcagcaagccttagtggacatctggaaatctaagcttactgtaaataaactgaagcacgttactcacccaaataaacagttttcaggagaggaatctgtgtagattaatatccagcactcgtttgactttgaaatagctagatttgtatactgagacgctccaccggcaagcgaccacccccggtgggggaagggaaacatggcgccacccctgttcactttgatataggcaccctttctagtgtcacttaacgcgccttataatgcgatgcgccctatgtatggaaaaatagcagaaaataggcgttctttgatagtgcgtcttataatacggtgcgccttatagtccgaaaaatacggtatgtagcttgccatcagctgc

Function

NR:

description
sushi, nidogen and EGF-like domain-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU4203 True 996 lncRNA 0.29 3 12577080 12658307

Neighbor

gene id symbol gene type direction distance location
LOC103027225 NA coding upstream 666549 11884302 ~ 11910531 (+)
LOC103026933 LOC108426918 coding upstream 697010 11876926 ~ 11880070 (+)
LOC103031523 NA coding upstream 704739 11851902 ~ 11872341 (+)
LOC103031217 mag,LOC108427016,LOC108277883,LOC107752306,LOC107683144,LOC107587088,LOC107704773 coding upstream 733159 11810175 ~ 11843921 (+)
LOC103026019 lsr,LOC108427013 coding upstream 771482 11791031 ~ 11805598 (+)
sacs sacs,LOC107670382,LOC107724954 coding downstream 49902 12708209 ~ 12753900 (+)
trappc4 trappc4,LOC107561742,LOC106612982 coding downstream 130594 12788901 ~ 12793303 (+)
LOC103023132 LOC108426979,LOC108278227,LOC107567275 coding downstream 345230 13003537 ~ 13028805 (+)
LOC103023447 LOC108426981,LOC108278228,LOC107380297,LOC103474627,LOC102221837,LOC107746191 coding downstream 376173 13034480 ~ 13042611 (+)
LOC103022831 rab4b,LOC103022831,LOC108426982,LOC107567272,LOC107592649,LOC103378089,LOC107699834,LOC100706225 coding downstream 466475 13124782 ~ 13150184 (+)
G3179 NA non-coding upstream 324468 12246977 ~ 12252612 (+)
G3129 gbe1 non-coding upstream 468044 12106391 ~ 12109036 (+)
LOC111196183 NA non-coding upstream 618615 11958075 ~ 11958465 (+)
G2983 NA non-coding upstream 822969 11731522 ~ 11754111 (+)
LOC111195845 arl4a,arl4aa non-coding upstream 865732 11698557 ~ 11711348 (+)
G3232 NA non-coding downstream 56311 12714618 ~ 12720840 (+)
LOC111197033 NA non-coding downstream 331278 12989585 ~ 12992123 (+)
G3323 NA non-coding downstream 340738 12999045 ~ 12999446 (+)
G3342 ap2s1 non-coding downstream 417290 13075597 ~ 13205546 (+)
G3377 tmem160 non-coding downstream 804788 13463095 ~ 13464950 (+)
G3096 NA other upstream 649830 11924450 ~ 11927250 (+)
meox2 meox2,LOC103024054,LOC107683451,LOC107730826,LOC107582293,LOC107588208,LOC107704718 other upstream 1152629 11405543 ~ 11424451 (+)
G2910 sarm1,LOC107756984 other upstream 1288234 11288131 ~ 11288846 (+)
LOC103029949 slc46a1 other upstream 1297903 11258446 ~ 11279177 (+)
LOC103039705 gdpd5b,gdpd5,LOC103039705,LOC108433002,LOC108277648,LOC107666190,LOC107682503 other upstream 2833589 9634093 ~ 9743491 (+)
G3313 sept5b,LOC108425237 other downstream 324318 12982625 ~ 12984269 (+)
LOC103035587 NA other downstream 1559500 14217807 ~ 14244380 (+)
LOC103039352 nova2,LOC103039352,LOC108440380,LOC108277822,LOC107669728,LOC107589717,LOC107756760,LOC107379798 other downstream 1786251 14444558 ~ 14505015 (+)
LOC107197063 capns1,LOC108425806,LOC105901516,LOC107700232,LOC107548486 other downstream 2181986 14840293 ~ 14845626 (+)
G3736 NA other downstream 2302866 14961173 ~ 14963583 (+)

Expression


Co-expression Network