G5667 (c2cd3)


Basic Information

Item Value
gene id G5667
gene name c2cd3
gene type unknown
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035897.1
NCBI id CM008300.1
chromosome length 26953843
location 22796345 ~ 22798290 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU7659
CGGGATTCCTCCCACAGCGCTGGGACCCTGGCTGGCCAAAGAGCTGAGCAGCAGTCTCTGTACTGGAACAGCTGGAGAAGCCACAAGAACGTGGGTCTCAGAGTGACCAAACACTAGATCAGGCACACACAGTGTGGTGACAGTTCGGTACGACTTCAGATTCACACTGCTCTCCACTACATGTGGGTCAACATCCTGCCTGGCATCGTCCTCCTGAGCAGGAAACGAGTAGTGGATGTAGCAGTCTGCTTCTCCCCAGACGGTGGACTGGAGAGGAGTCAGTCCTCTCACCTTCTCCACTCGAACCACAAACACGTGTTCATTCAGAGCCGTGGCGGGAGCAGCATTCGCCTCTGGAACTGGTCTGTGATCCAGCAGGTGGGCTGGTCTGGGTATCTGAGACACAGAGGCCAGTTCCTCGTCTCTCATGCGCTGGAGGGACGTGATCTGCTGGGACAGGCCCATGGCCAGACACACCCTCAGTCTCCCCCGAGTTCCTCCAGTGAAGATGTCCACGACAGGCATGTAGCTGTCCACTGCCAGCACTGGATACTGAGACTTCAGCAGCAGCTGGGAAATCTTCGGGTCTCT

Function

symbol description
c2cd3 Predicted to be involved in centriole elongation and cilium assembly. Predicted to be active in centriolar satellite and centriole. Human ortholog(s) of this gene implicated in orofaciodigital syndrome. Orthologous to human C2CD3 (C2 domain containing 3 centriole elongation regulator).

NR:

description
PREDICTED: C2 domain-containing protein 3 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU7659 True 591 TUCP 0.53 3 22796345 22798290

Neighbor

gene id symbol gene type direction distance location
LOC103040843 tyr coding downstream 97095 22692855 ~ 22699250 (-)
folh1b folh1b,LOC107737433,LOC107670141,LOC107560856,LOC108412465,LOC107558820 coding downstream 129843 22651657 ~ 22666502 (-)
trnag-ucc_3 NA coding downstream 210137 22586137 ~ 22586208 (-)
trnag-ucc_2 NA coding downstream 220199 22576075 ~ 22576146 (-)
trnag-ucc_1 NA coding downstream 220797 22575477 ~ 22575548 (-)
LOC111192983 NA coding upstream 15165 22813455 ~ 22816901 (-)
LOC103021402 ywhag2,LOC103021402,LOC101160255,LOC107582613,LOC107694031,LOC100700540 coding upstream 44409 22842699 ~ 22854595 (-)
LOC103023370 NA coding upstream 132025 22930315 ~ 22934263 (-)
LOC103022556 rab34a,LOC103022556,LOC108443499,LOC107758713,LOC107672399,LOC107657101 coding upstream 149304 22947594 ~ 22954020 (-)
LOC103023685 LOC108443500 coding upstream 157618 22955908 ~ 22964905 (-)
G5658 rab38,LOC103046565,LOC102778643 non-coding downstream 24278 22771779 ~ 22772067 (-)
G5568 NA non-coding downstream 146436 22648369 ~ 22649909 (-)
G5570 NA non-coding downstream 154510 22638058 ~ 22641835 (-)
G5537 lamtor1,LOC106581407 non-coding downstream 192988 22473480 ~ 22603357 (-)
G5541 LOC107756230,LOC107756206,LOC107689577,LOC107670112,LOC107725765 non-coding downstream 299468 22492050 ~ 22496877 (-)
G5682 NA non-coding upstream 71603 22869893 ~ 22871089 (-)
G5687 NA non-coding upstream 88700 22886990 ~ 22892910 (-)
G5690 NA non-coding upstream 98046 22896336 ~ 22911382 (-)
G5691 NA non-coding upstream 106431 22904721 ~ 22920046 (-)
G5692 NA non-coding upstream 108650 22906940 ~ 22915027 (-)
G5565 NA other downstream 168163 22607769 ~ 22628182 (-)
G5396 NA other downstream 596037 22131234 ~ 22200308 (-)
G5407 NA other downstream 638160 22155785 ~ 22158185 (-)
LOC111192507 NA other downstream 834880 21946786 ~ 21961465 (-)
inppl1 inppl1,inppl1a,LOC108261207 other downstream 855539 21916366 ~ 21940806 (-)
LOC103028862 dynll2a,LOC107554284,LOC103397138 other upstream 536776 23335066 ~ 23339735 (-)
srsf1 srsf1a,srsf1b,LOC103029385,LOC108415197,LOC107587230,LOC107704814,LOC108278759,LOC108278234 other upstream 546206 23344496 ~ 23351222 (-)
LOC103033507 fam222bb,LOC107661104 other upstream 750434 23548724 ~ 23560500 (-)
LOC103035104 LOC103035104,LOC108443709,LOC108277991 other upstream 1045965 23844255 ~ 23856637 (-)
hip1 hip1,LOC107659933 other upstream 1117762 23916052 ~ 23978227 (-)

Expression


Co-expression Network