LOC111193405



Basic Information


Item Value
gene id LOC111193405
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information


Item Value
chromosome id NC_035907.1
NCBI id CM008310.1
chromosome length 11650534
location 431659 ~ 432393 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence


>XR_002650509.1
GTAGCCGCTGAGGGAGCTCACCCCCATACCGGTCAGGTATGGATCCCCGGTGGAGGAGCAGACCTCTTCCAATAGTGGCGCAGTCAGGAAACTTTAGCTTCAGGACTCGTCCTGTGTCTCTGTGGCAGGGTGAAGAGCCAGCG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_002650509.1 True 143 ncRNA 0.59 3 431659 432393
Loading

Neighbor


gene id symbol gene type direction distance location
LOC103040905 NA coding downstream 55229 366617 ~ 376430 (-)
LOC103042121 LOC108432773 coding downstream 99512 301691 ~ 332147 (-)
mrap2 mrap2 coding downstream 189213 234312 ~ 242446 (-)
dcakd dcakd,LOC107667188,LOC107747896,LOC107717668,LOC107554516 coding upstream 104053 536446 ~ 545019 (-)
LOC103037419 LOC108429189,LOC108272415 coding upstream 119045 551438 ~ 573290 (-)
LOC111193396 NA coding upstream 143118 575511 ~ 576556 (-)
dnaaf3 NA coding upstream 266330 698723 ~ 711111 (-)
gnptg gnptg coding upstream 304343 736736 ~ 743730 (-)
G96039 NA non-coding downstream 29781 399836 ~ 401878 (-)
G96038 NA non-coding downstream 34282 395816 ~ 397377 (-)
G95988 NA non-coding downstream 205403 225396 ~ 226256 (-)
G95968 NA non-coding downstream 283444 145913 ~ 148215 (-)
G96051 NA non-coding upstream 57983 490376 ~ 490995 (-)
G96056 NA non-coding upstream 93556 525949 ~ 526283 (-)
G96057 NA non-coding upstream 94014 526407 ~ 526761 (-)
G96058 NA non-coding upstream 95041 527434 ~ 527761 (-)
G96081 NA non-coding upstream 146099 578492 ~ 579159 (-)
LOC103043490 NA other downstream 166065 252340 ~ 265594 (-)
carmil1 carmil1 other upstream 1149614 1582007 ~ 1778100 (-)
LOC103031019 NA other upstream 1379308 1811701 ~ 1815034 (-)
mboat1 mboat1 other upstream 3446303 3878696 ~ 3899248 (-)
LOC107197182 NA other upstream 3717610 4150003 ~ 4178426 (-)
dek dek other upstream 4011836 4444229 ~ 4453002 (-)

Expression


LOC111193405 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network