G158038 (ric8b)


Basic Information

Item Value
gene id G158038
gene name ric8b
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 14088466 ~ 14092532 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU214242
TCTCGAGTGGCTACAGGACCCAGTACTCGCTTGTCACGAGACAGAATGCGCATGGTCTCCAGGCAGGTGCTTTGGCACTGGGGCTGCACAGACTGTCTGAGCACAGTGAGCAATCCTTGACAGAGCTTTATTCGAGCATCTTCTTCGCCGCAATCAAAGGCAAACGTCTTACTGTTCTCTGTGTTGTATTCAAACAAACGCATCCTAATCTCCTCCTCGTTTCCACTCTCAATCTGTGTTAAAATATCACTCAGACCCATGTTTGCACCAACTGCACGCCACAGCTCCCAGCTAAGCGCTCAGTCCCCAGCAGAGGCTTCAGTCTGCAGCTCTGTAACCTCTAATATACGCCTCAACTTTTAACCGC

Function

symbol description
ric8b Predicted to enable G-protein alpha-subunit binding activity and guanyl-nucleotide exchange factor activity. Acts upstream of or within pigment cell development. Predicted to be active in cytoplasm and plasma membrane. Orthologous to human RIC8B (RIC8 guanine nucleotide exchange factor B).

NR:

description
PREDICTED: synembryn-B isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU214242 True 367 lncRNA 0.50 3 14088466 14092532

Neighbor

gene id symbol gene type direction distance location
LOC103043515 LOC108419231,LOC105022153 coding upstream 12928 14059803 ~ 14075538 (+)
LOC103042895 LOC108425440,LOC107740436,LOC107583921,LOC107672215,LOC107749314,LOC107553958 coding upstream 66042 14008015 ~ 14022424 (+)
cry1 cry1,cry1ab,LOC107672239,LOC108426403,LOC103023024 coding upstream 116142 13961055 ~ 13972324 (+)
uri1 uri1 coding upstream 413086 13666685 ~ 13675380 (+)
spata2l NA coding upstream 424133 13659930 ~ 13664333 (+)
LOC103047487 slc17a8,LOC107672209,LOC107583818,LOC107553956 coding downstream 137948 14230480 ~ 14247822 (+)
nr1h4 nr1h4,LOC106573302,LOC106561422,LOC107672305 coding downstream 159864 14252396 ~ 14277266 (+)
LOC103046676 LOC108430366 coding downstream 188367 14280899 ~ 14301400 (+)
ube2n ube2na,ube2nb,ube2n,LOC105897570,LOC107707098,LOC107658971,LOC106609528 coding downstream 215836 14308368 ~ 14321858 (+)
nudt4 nudt4,LOC107553971,LOC107740279,LOC107672310,LOC107686239,LOC105898052 coding downstream 230680 14323212 ~ 14342320 (+)
G158045 mterf2 non-coding upstream 101308 13983946 ~ 13987158 (+)
G158023 NA non-coding upstream 239167 13848642 ~ 13849299 (+)
G157943 NA non-coding upstream 743002 13275460 ~ 13345464 (+)
G157933 cdh13,LOC107684661,LOC107722459 non-coding upstream 1105995 12974488 ~ 12982471 (+)
G157926 NA non-coding upstream 1225810 12862389 ~ 12862656 (+)
G158068 NA non-coding downstream 23787 14116319 ~ 14116843 (+)
G158085 NA non-coding downstream 56954 14149486 ~ 14150489 (+)
G158086 endouc,LOC108425714,LOC107749311,LOC107686338,LOC107672228 non-coding downstream 58886 14151418 ~ 14157033 (+)
G158093 ppfibp1 non-coding downstream 76427 14168959 ~ 14190042 (+)
G158238 NA non-coding downstream 468118 14560650 ~ 14562131 (+)
LOC103042073 LOC103042073,LOC108418727 other upstream 108441 13973821 ~ 13980025 (+)
LOC107197649 LOC108416831 other upstream 345966 13733945 ~ 13742500 (+)
hsbp1 hsbp1,hsbp1b,LOC107583924,LOC107553992,LOC107670150,LOC107749299 other upstream 1347464 12735519 ~ 12741002 (+)
LOC103031933 ttc38,LOC103031933,LOC108414465,LOC104940279,LOC106573176,LOC100694777,LOC107722483,LOC107673144 other upstream 1721696 12340006 ~ 12366770 (+)
hipk2 hipk2,LOC107722467 other upstream 2944995 11031065 ~ 11143471 (+)
G158369 NA other downstream 957690 15050222 ~ 15050718 (+)
LOC111194769 NA other downstream 1035836 15128368 ~ 15137270 (+)
c18h11orf16 NA other downstream 1213680 15306212 ~ 15315552 (+)
LOC103041858 NA other downstream 1675523 15768055 ~ 15768661 (+)
LOC107197617 NA other downstream 1678763 15771295 ~ 15771945 (+)

Expression


Co-expression Network