G158429


Basic Information

Item Value
gene id G158429
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 15142172 ~ 15142472 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU214769
ggggggggggtgctggagcctatcccagcaggcatcgggcggaaggcaggatacaccctggacaggccgccaatccatcgcagggcagacggacacagacagacaaacagacacattcactcacacactcacacctaaggggcaatttcaatcaagttccaattagcctgaacgtgccgtctttggactgtgggaggaaaccggaggaacctccacacagaaagacccgggttgccccagccgggaatcgaacccaggccgt

Function

GO:

id name namespace
GO:0051179 localization biological_process
GO:0051234 establishment of localization biological_process
GO:0015672 monovalent inorganic cation transport biological_process
GO:0030001 metal ion transport biological_process
GO:0006810 transport biological_process
GO:0006811 ion transport biological_process
GO:0006812 cation transport biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU214769 True 262 lncRNA 0.59 2 15142172 15142472

Neighbor

gene id symbol gene type direction distance location
LOC103031502 eif4g2b,LOC108431851,LOC107730533,LOC107569652,LOC103379577 coding upstream 21867 15107363 ~ 15120305 (+)
LOC103031823 LOC108263962,LOC107740339,LOC107583811 coding upstream 311828 14818068 ~ 14830344 (+)
nts nts coding upstream 404445 14731792 ~ 14737727 (+)
alx1 alx1 coding upstream 498673 14636792 ~ 14643499 (+)
lrriq1 NA coding upstream 509980 14588458 ~ 14632192 (+)
LOC103024643 NA coding downstream 1600 15144072 ~ 15148635 (+)
rnf141 rnf141,LOC107672299,LOC107740332 coding downstream 7579 15150051 ~ 15155609 (+)
nrip3 nrip3 coding downstream 156473 15298945 ~ 15304011 (+)
LOC103021723 LOC108426425 coding downstream 178798 15321270 ~ 15331330 (+)
LOC111194727 NA coding downstream 191401 15333873 ~ 15335002 (+)
G158419 NA non-coding upstream 17178 15124789 ~ 15124994 (+)
G158417 NA non-coding upstream 18503 15123138 ~ 15123669 (+)
G158381 NA non-coding upstream 71763 15069786 ~ 15070409 (+)
G158359 NA non-coding upstream 134089 15007505 ~ 15008083 (+)
G158357 NA non-coding upstream 162080 14978743 ~ 14980092 (+)
LOC107197619 NA non-coding downstream 60712 15203184 ~ 15213993 (+)
G158449 NA non-coding downstream 105147 15247619 ~ 15249375 (+)
G158467 wee1,LOC108264466,LOC107686254,LOC107580369,LOC107758614,LOC107740329,LOC107583885 non-coding downstream 135151 15277623 ~ 15280021 (+)
G158472 znf143,znf143b,LOC107672322,LOC107583804 non-coding downstream 142432 15284904 ~ 15290727 (+)
G158461 znf143,znf143b non-coding downstream 148969 15291441 ~ 15295392 (+)
LOC111194769 NA other upstream 4902 15128368 ~ 15137270 (+)
G158369 NA other upstream 91454 15050222 ~ 15050718 (+)
LOC103042073 LOC103042073,LOC108418727 other upstream 1162147 13973821 ~ 13980025 (+)
LOC107197649 LOC108416831 other upstream 1399672 13733945 ~ 13742500 (+)
hsbp1 hsbp1,hsbp1b,LOC107583924,LOC107553992,LOC107670150,LOC107749299 other upstream 2401170 12735519 ~ 12741002 (+)
c18h11orf16 NA other downstream 163740 15306212 ~ 15315552 (+)
LOC103041858 NA other downstream 625583 15768055 ~ 15768661 (+)
LOC107197617 NA other downstream 628823 15771295 ~ 15771945 (+)
LOC103041352 NA other downstream 632952 15775424 ~ 15776166 (+)
G158779 NA other downstream 1236787 16379259 ~ 16379823 (+)

Expression


Co-expression Network