G158877 (megf11)


Basic Information

Item Value
gene id G158877
gene name megf11
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 16998804 ~ 16999039 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU215363
ATGTACCCTGGGGCACAGATGCATTCTCCAGTCTCATGGTGGCAGGTGGCACCGTTAAGACACTGGCACTGCAGCTGGCATCCCTTGCCATAGTAGCCCGGCTCACAGTGATCTTCGCAGCGCCAGCCCTGGTAGCCGTCAGTGCAGACACAGGCTCCGGTGATGGGGTTACACAGAGCTCCATTCTGGCACTGGCAGCGGTTACTGCAGTGTGGCCCCCAGTAACCACTCTCACA

Function

symbol description
megf11 Predicted to enable zinc ion binding activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human MEGF11 (multiple EGF like domains 11).

NR:

description
multiple epidermal growth factor-like domains protein 11 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU215363 True 236 lncRNA 0.59 1 16998804 16999039

Neighbor

gene id symbol gene type direction distance location
rab11a rab11a,LOC105007892,LOC106591986,LOC100698633,LOC106588008,LOC103378951,LOC106562755 coding upstream 67442 16921369 ~ 16931362 (+)
slc24a1 slc24a1,LOC107738725,LOC107596980,LOC107742879,LOC107686291 coding upstream 114649 16859892 ~ 16884155 (+)
hacd3 hacd3,LOC107738726,LOC107686290,LOC107672296,LOC107596982,LOC107583769,LOC107742880 coding upstream 146345 16842661 ~ 16852459 (+)
pllp pllp coding upstream 225804 16764032 ~ 16773000 (+)
trnal-cag_11 NA coding upstream 235196 16763526 ~ 16763608 (+)
LOC107197433 NA coding downstream 296168 17295207 ~ 17301682 (+)
LOC103027004 smad3,LOC108424035,LOC105892538,LOC103353199,LOC107740443 coding downstream 426179 17425218 ~ 17447793 (+)
iqch NA coding downstream 458976 17458015 ~ 17492931 (+)
c18h15orf61 cunh15orf61,c4h15orf61,LOC103025902,LOC107738714,LOC107583911,LOC107718314,LOC107686305,LOC107596966 coding downstream 494754 17493793 ~ 17498771 (+)
LOC103029280 skor1 coding downstream 564836 17563875 ~ 17571917 (+)
G158876 NA non-coding upstream 3386 16995117 ~ 16995418 (+)
G158875 NA non-coding upstream 9753 16988770 ~ 16989051 (+)
G158874 megf11 non-coding upstream 50048 16948464 ~ 16948756 (+)
G158873 NA non-coding upstream 59072 16939528 ~ 16939732 (+)
G158855 NA non-coding upstream 117964 16880518 ~ 16880840 (+)
G158878 NA non-coding downstream 80073 17079112 ~ 17083738 (+)
G158881 NA non-coding downstream 84914 17083953 ~ 17084261 (+)
G158891 NA non-coding downstream 158103 17157142 ~ 17158451 (+)
G158882 rpl4 non-coding downstream 174028 17173067 ~ 17177192 (+)
G158991 NA non-coding downstream 284428 17283467 ~ 17283882 (+)
LOC103031606 arih1,LOC108423892,LOC107742882,LOC107672283,LOC107549652,LOC105892496 other upstream 200404 16779506 ~ 16798400 (+)
st3gal2 st3gal2,LOC107686287,LOC106573711 other upstream 273595 16654136 ~ 16725209 (+)
siah1 siah1,LOC107549647,LOC107742888,LOC106573709 other upstream 427346 16542878 ~ 16571458 (+)
G158779 NA other upstream 618981 16379259 ~ 16379823 (+)
LOC103041352 NA other upstream 1222638 15775424 ~ 15776166 (+)
map2k1 map2k1,LOC107596971,LOC107583767,LOC107686295 other downstream 102573 17101612 ~ 17172228 (+)
zwilch zwilch other downstream 178636 17177675 ~ 17189251 (+)
smad6 smad6,smad6b,LOC107583766,LOC107672304,LOC107596967,LOC107738716,LOC107686299 other downstream 328061 17327100 ~ 17372206 (+)
rapsn rapsn other downstream 972057 17971096 ~ 17985904 (+)
necab2 necab2,LOC107694920,LOC107672281,LOC106573751 other downstream 1526489 18525528 ~ 18576437 (+)

Expression


Co-expression Network