G159184 (asz1)


Basic Information

Item Value
gene id G159184
gene name asz1
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 18114005 ~ 18128429 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU215773
CGTGTGGCCGCTATCATCCTGAAAGTCCAGTTCAGCTCCATGAGATACCAGCAGATTGATCAAATGAGAGTAGTTGTCCCTGGCAGCCAACATCAGGCACGTCATGCGGCTCCTGGTGTAGATGTTGGGGTCGGCATTGCGATTCAGCAGTAGAGCTACACACTTAGCGATTTTCTCCTCAGTGGTAGAGTTTGCTGTGCATGCAGCCATCAGTACTGTATAATCATCTCTGCTGAAATTTGCACTTGCACCATGGTCCAGCAGCAGCTGGGTCAGGGTATAGTTGGACACATGGACAGCACACATGAGTGGAGTCCATCCAAAGCCCAACCTTGTCTCCACATCCATTCCACTTTCCAGAAGTTGCTGCACAAGATTGACATCCCCTGCAGAAATGGCTCTTTTCAAAACTGAAACATTGTCATCACTGGGTAAAGTTGACCCTGAAACCTCAGAATTTGGACTCTTGCTACCACTGGTATACCCTGTGTCCCATTCATCATTACTCCCATCACTCTCGTCACCCGCAGGAAAGCCGTAGTCTATCATATTGAGCGTGTTAACGCTAGATAATTAAACACGGGCCTTAATACAGGCGCTTTCACATCGCCAGCGGTATGCCGCGCTGCTTTCCGCTCTCCTGGACGCTGACCACCACTTGTGTTTGCGTTGTGCTACTGCTGAAGACGAGCCGAACTT

Function

symbol description
asz1 Predicted to be involved in piRNA metabolic process. Predicted to act upstream of or within several processes, including gene silencing by RNA; meiotic cell cycle; and spermatogenesis. Predicted to be located in cytoplasm and membrane. Predicted to be integral component of membrane. Predicted to be active in pi-body. Is expressed in oocyte stage I. Orthologous to human ASZ1 (ankyrin repeat, SAM and basic leucine zipper domain containing 1).

NR:

description
PREDICTED: ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU215773 True 699 lncRNA 0.50 5 18114005 18128429

Neighbor

gene id symbol gene type direction distance location
LOC107197792 LOC107197792 coding upstream 78309 18030488 ~ 18035696 (+)
wee2 wee2 coding upstream 84000 18023904 ~ 18030005 (+)
agk agk coding upstream 103451 18004007 ~ 18010554 (+)
LOC103029004 NA coding upstream 119635 17985993 ~ 17994370 (+)
kbtbd4 kbtbd4,LOC107708223,LOC107738697,LOC107596956,LOC107672308 coding upstream 145069 17964383 ~ 17968936 (+)
cftr cftr,LOC107738689,LOC107583749,LOC107596947,LOC107708216 coding downstream 6288 18134717 ~ 18164724 (+)
LOC103028633 NA coding downstream 132736 18261165 ~ 18265803 (+)
arpin arpin coding downstream 287098 18415527 ~ 18435115 (+)
kmt5b kmt5b,LOC107738677,LOC107694947,LOC107596936,LOC107583742,LOC108264420,LOC107726382,LOC107672243 coding downstream 333669 18462098 ~ 18468279 (+)
chka chka,LOC108424340,LOC107738676,LOC107726368,LOC107694945,LOC107583738 coding downstream 344507 18472936 ~ 18491526 (+)
G159182 NA non-coding upstream 4466 18108163 ~ 18109539 (+)
G159129 NA non-coding upstream 117277 17995698 ~ 17996728 (+)
G159122 NA non-coding upstream 167322 17942316 ~ 17946683 (+)
G159120 kif23,LOC107686310 non-coding upstream 175917 17926988 ~ 17938088 (+)
G159115 NA non-coding upstream 243537 17870007 ~ 17870468 (+)
G159272 NA non-coding downstream 282883 18411312 ~ 18411936 (+)
LOC111194744 NA non-coding downstream 284932 18413361 ~ 18413950 (+)
G159274 NA non-coding downstream 299726 18428155 ~ 18428426 (+)
G159298 NA non-coding downstream 379982 18508411 ~ 18508695 (+)
G159344 NA non-coding downstream 484735 18613164 ~ 18615494 (+)
rapsn rapsn other upstream 128101 17971096 ~ 17985904 (+)
smad6 smad6,smad6b,LOC107583766,LOC107672304,LOC107596967,LOC107738716,LOC107686299 other upstream 741799 17327100 ~ 17372206 (+)
zwilch zwilch other upstream 924754 17177675 ~ 17189251 (+)
map2k1 map2k1,LOC107596971,LOC107583767,LOC107686295 other upstream 941777 17101612 ~ 17172228 (+)
LOC103031606 arih1,LOC108423892,LOC107742882,LOC107672283,LOC107549652,LOC105892496 other upstream 1315605 16779506 ~ 16798400 (+)
necab2 necab2,LOC107694920,LOC107672281,LOC106573751 other downstream 397099 18525528 ~ 18576437 (+)
G159666 NA other downstream 2057087 20185516 ~ 20186919 (+)
G159728 NA other downstream 2608169 20736598 ~ 20737049 (+)
G159748 chd2,LOC107715217,LOC107601632,LOC107549011,LOC107715589,LOC107690375 other downstream 2880873 21009302 ~ 21011794 (+)
fam174b NA other downstream 2932227 21060656 ~ 21074573 (+)

Expression


Co-expression Network