G161755


Basic Information

Item Value
gene id G161755
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 30689715 ~ 30689944 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU219151
ttatttcaatccagtgttgcattaattaatttttcaccaagatcttgcagcagcattgatgatggtagagtctgaccactgcacaaagcagctcttctccatccagcacatcccaaagattctcaatgaggttaagatctggactctgtggtgaactctctcaatccatgtgtgaaaatgatgatctcatgatccctgaaccctgaactctttcacaattccagccccat

Function

GO:

id name namespace
GO:0009250 glucan biosynthetic process biological_process
GO:0006073 cellular glucan metabolic process biological_process
GO:0033692 cellular polysaccharide biosynthetic process biological_process
GO:0006112 energy reserve metabolic process biological_process
GO:0044262 cellular carbohydrate metabolic process biological_process
GO:0044264 cellular polysaccharide metabolic process biological_process
GO:0015980 energy derivation by oxidation of organic compounds biological_process
GO:0005976 polysaccharide metabolic process biological_process
GO:0005977 glycogen metabolic process biological_process
GO:0005978 glycogen biosynthetic process biological_process
GO:0034637 cellular carbohydrate biosynthetic process biological_process
GO:0044042 glucan metabolic process biological_process
GO:0000271 polysaccharide biosynthetic process biological_process
GO:0016051 carbohydrate biosynthetic process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU219151 True 230 lncRNA 0.42 1 30689715 30689944

Neighbor

gene id symbol gene type direction distance location
LOC111194807 NA coding upstream 17446 30661882 ~ 30672269 (+)
lysmd2 lysmd2 coding upstream 247839 30431447 ~ 30441876 (+)
LOC103035823 bcl2l10 coding upstream 586738 30090299 ~ 30102977 (+)
LOC103042250 gnb5,gnb5b,LOC107700591,LOC107588534,LOC107704270,LOC106562494,LOC106518983,LOC102225297 coding upstream 601005 30036411 ~ 30088710 (+)
myo5a myo5a coding upstream 661967 29901316 ~ 30027748 (+)
LOC111194808 LOC102215143 coding downstream 108194 30798138 ~ 30800224 (+)
LOC103039032 NA coding downstream 281228 30971172 ~ 30983860 (+)
slc9a1 slc9a1,LOC108256597,LOC107688187,LOC107671463,LOC107552533,LOC107564092 coding downstream 474094 31164038 ~ 31255308 (+)
znf385d znf385d,LOC107688204 coding downstream 691273 31381217 ~ 31514641 (+)
satb1 satb1,LOC107569796 coding downstream 998108 31688052 ~ 31802563 (+)
G161746 NA non-coding upstream 28988 30660320 ~ 30660727 (+)
G161745 NA non-coding upstream 52418 30637057 ~ 30637297 (+)
G161697 NA non-coding upstream 354407 30333222 ~ 30335308 (+)
G161696 NA non-coding upstream 363861 30324160 ~ 30325854 (+)
G161695 NA non-coding upstream 367787 30315607 ~ 30321928 (+)
G161754 NA non-coding downstream 5595 30695539 ~ 30696723 (+)
G161763 NA non-coding downstream 69400 30759344 ~ 30796827 (+)
G161775 NA non-coding downstream 155786 30845730 ~ 30846030 (+)
LOC103039351 NA non-coding downstream 200389 30890333 ~ 30915250 (+)
G161797 LOC108426366,LOC108256083,LOC107552531,LOC107688188,LOC107707635,LOC107726719,LOC107671482 non-coding downstream 338044 31027988 ~ 31035682 (+)
LOC103042463 tmod3,LOC108440576,LOC108264495 other upstream 275503 30353686 ~ 30414212 (+)
G161331 NA other upstream 1572920 29070820 ~ 29116795 (+)
fam219b fam219b other upstream 1930708 28745696 ~ 28759007 (+)
G161292 rap2b,LOC107757383 other upstream 2064930 28622128 ~ 28624785 (+)
c18h3orf33 NA other upstream 2893211 27784896 ~ 27796504 (+)
dhdds dhdds,LOC106582847,LOC106605152 other downstream 164614 30854558 ~ 30894506 (+)
hmgn2 NA other downstream 185094 30875038 ~ 30878327 (+)
efhb NA other downstream 894802 31584746 ~ 31605490 (+)
G162017 NA other downstream 1378918 32068862 ~ 32148190 (+)
G162032 NA other downstream 1546372 32236316 ~ 32295029 (+)

Expression


Co-expression Network