G162505


Basic Information

Item Value
gene id G162505
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 34501600 ~ 34517219 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU220132
aagagcacagttctgctctaaatattgcaatgcacacaacattatgggtgacataccagagttcaaaagaggacaaattgttggtgcacgtcttgctggagcatctgtgaccaagacagcatctttgtgatgcatcaagagccacggtatccagggtaatgtcagcacaccaccaagaaggaccaaccacatccaacaggattaactgtggatgct

Function

GO:

id name namespace
GO:0004300 enoyl-CoA hydratase activity molecular_function

KEGG:

id description
ko00071 Fatty acid degradation
ko00280 Valine, leucine and isoleucine degradation

RNA

RNA id representative length rna type GC content exon number start site end site
TU220132 True 216 lncRNA 0.46 2 34501600 34517219

Neighbor

gene id symbol gene type direction distance location
LOC103044586 NA coding upstream 151720 34319213 ~ 34349880 (+)
mios mios,LOC107671474,LOC107592123,LOC107592481 coding upstream 186376 34300018 ~ 34315224 (+)
LOC103027681 NA coding upstream 283797 34213886 ~ 34217803 (+)
LOC103028011 LOC108413592 coding upstream 301828 34176108 ~ 34199772 (+)
LOC111194818 LOC108413590,LOC105891915,LOC107592482,LOC108441798 coding upstream 339846 34118793 ~ 34161754 (+)
pepd pepd coding downstream 290287 34807506 ~ 34839027 (+)
chst8 chst8,LOC108264314,LOC107668469 coding downstream 550099 35067318 ~ 35512777 (+)
kctd15 kctd15,LOC107668486,LOC107712586,LOC107594376,LOC106562374 coding downstream 1032673 35549892 ~ 35603715 (+)
lsm14a NA coding downstream 1269111 35786330 ~ 35803285 (+)
gpi gpi,gpib,LOC107659049,LOC107712583,LOC108431707 coding downstream 1371735 35888954 ~ 35909612 (+)
G162442 NA non-coding upstream 102152 34399234 ~ 34399448 (+)
G162408 NA non-coding upstream 280264 34220112 ~ 34221336 (+)
G162405 NA non-coding upstream 298494 34202903 ~ 34203106 (+)
G162403 NA non-coding upstream 324373 34170400 ~ 34177227 (+)
G162373 NA non-coding upstream 404003 34093913 ~ 34097597 (+)
G162518 NA non-coding downstream 137742 34654961 ~ 34655440 (+)
G162530 NA non-coding downstream 259988 34777207 ~ 34783691 (+)
G162533 NA non-coding downstream 275314 34792533 ~ 34792826 (+)
G162534 NA non-coding downstream 275680 34792899 ~ 34793146 (+)
G162535 NA non-coding downstream 276350 34793569 ~ 34793832 (+)
G162096 LOC103040777,LOC108439298,LOC108256343,LOC101172525 other upstream 1782325 32714183 ~ 32719275 (+)
G162032 NA other upstream 2206571 32236316 ~ 32295029 (+)
G162017 NA other upstream 2353410 32068862 ~ 32148190 (+)
efhb NA other upstream 2896110 31584746 ~ 31605490 (+)
hmgn2 NA other upstream 3623273 30875038 ~ 30878327 (+)
ss18l2 ss18l2,kiaa0355 other downstream 1290646 35807865 ~ 35814793 (+)
pygo1 pygo1 other downstream 1594823 36112042 ~ 36120402 (+)
ccpg1 ccpg1 other downstream 1615196 36132415 ~ 36169745 (+)
G162964 LOC108431875,LOC108413582 other downstream 2236966 36754185 ~ 36754687 (+)
LOC103046025 hcn4,LOC108263998 other downstream 2769948 37287167 ~ 37352779 (+)

Expression


Co-expression Network