G162535


Basic Information

Item Value
gene id G162535
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 34793569 ~ 34793832 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU220167
aactaaactattccaggtgattctacctcatgaagactctgagaaaactaaactattccaggtgattctacctcatgaagactctgataaaactaaactattccaggtgattctacctcatgaagactctgagaaaactaaactattccaggtgattctacctcatgaagactctgataaaactaaactattccaggtgactctacctcatgaagactctgataaaactaaactattccaggtgattctacctcatgaagactc

Function

NR:

description
PREDICTED: neuropilin and tolloid-like protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU220167 True 264 lncRNA 0.37 1 34793569 34793832

Neighbor

gene id symbol gene type direction distance location
LOC103044586 NA coding upstream 443689 34319213 ~ 34349880 (+)
mios mios,LOC107671474,LOC107592123,LOC107592481 coding upstream 478345 34300018 ~ 34315224 (+)
LOC103027681 NA coding upstream 575766 34213886 ~ 34217803 (+)
LOC103028011 LOC108413592 coding upstream 593797 34176108 ~ 34199772 (+)
LOC111194818 LOC108413590,LOC105891915,LOC107592482,LOC108441798 coding upstream 631815 34118793 ~ 34161754 (+)
pepd pepd coding downstream 13674 34807506 ~ 34839027 (+)
chst8 chst8,LOC108264314,LOC107668469 coding downstream 273486 35067318 ~ 35512777 (+)
kctd15 kctd15,LOC107668486,LOC107712586,LOC107594376,LOC106562374 coding downstream 756060 35549892 ~ 35603715 (+)
lsm14a NA coding downstream 992498 35786330 ~ 35803285 (+)
gpi gpi,gpib,LOC107659049,LOC107712583,LOC108431707 coding downstream 1095122 35888954 ~ 35909612 (+)
G162534 NA non-coding upstream 423 34792899 ~ 34793146 (+)
G162533 NA non-coding upstream 743 34792533 ~ 34792826 (+)
G162530 NA non-coding upstream 9878 34777207 ~ 34783691 (+)
G162518 NA non-coding upstream 138129 34654961 ~ 34655440 (+)
G162505 NA non-coding upstream 276350 34501600 ~ 34517219 (+)
G162581 NA non-coding downstream 50455 34844287 ~ 34892308 (+)
G162583 NA non-coding downstream 114905 34908737 ~ 34909108 (+)
LOC111194737 NA non-coding downstream 151812 34945644 ~ 34954135 (+)
G162597 NA non-coding downstream 298039 35091871 ~ 35093395 (+)
G162599 NA non-coding downstream 367549 35161381 ~ 35175910 (+)
G162096 LOC103040777,LOC108439298,LOC108256343,LOC101172525 other upstream 2074294 32714183 ~ 32719275 (+)
G162032 NA other upstream 2498540 32236316 ~ 32295029 (+)
G162017 NA other upstream 2645379 32068862 ~ 32148190 (+)
efhb NA other upstream 3188079 31584746 ~ 31605490 (+)
hmgn2 NA other upstream 3915242 30875038 ~ 30878327 (+)
ss18l2 ss18l2,kiaa0355 other downstream 1014033 35807865 ~ 35814793 (+)
pygo1 pygo1 other downstream 1318210 36112042 ~ 36120402 (+)
ccpg1 ccpg1 other downstream 1338583 36132415 ~ 36169745 (+)
G162964 LOC108431875,LOC108413582 other downstream 1960353 36754185 ~ 36754687 (+)
LOC103046025 hcn4,LOC108263998 other downstream 2493335 37287167 ~ 37352779 (+)

Expression


Co-expression Network