G163247


Basic Information

Item Value
gene id G163247
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 37985058 ~ 37987068 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU221103
ACCTCGTAACCCTCTGTATTGATGGTGAAAAACATGGTGAAGGGAGCTCCCTTGGTGAACGGCTCGGCTGAAGCTGATTCCTCACTCTCCCACTTCCCGTTCCTGCAGCTGCTCAGAGTCACTTTCTGACCAATGAGTGGGTTGAAGTGGAGAGCGACGTCGTCCCCATCTGATGATCCAGTCTTGAAGTTTATGGCAAAC

Function

GO:

id name namespace
GO:0031667 response to nutrient levels biological_process
GO:0009991 response to extracellular stimulus biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU221103 True 201 lncRNA 0.52 2 37985058 37987068

Neighbor

gene id symbol gene type direction distance location
LOC103021700 LOC103021700,LOC102310173,LOC102785042,LOC102211940,LOC101470544 coding upstream 38809 37944201 ~ 37946249 (+)
LOC111194820 celf6 coding upstream 149158 37589985 ~ 37835900 (+)
parp6 parp6 coding upstream 477861 37455735 ~ 37507197 (+)
LOC103045107 dhdh,LOC108431994,LOC107665090,LOC106587215 coding upstream 577144 37401528 ~ 37407914 (+)
LOC103045417 NA coding upstream 585219 37387494 ~ 37399839 (+)
LOC111194723 LOC107704663 coding downstream 957334 38944402 ~ 38945904 (+)
LOC111194822 LOC107569781 coding downstream 959108 38946176 ~ 38951124 (+)
LOC111194738 LOC104947953,LOC106536897 coding downstream 1105411 39092479 ~ 39094807 (+)
LOC103046335 ch25hl1.2,LOC108435345,LOC107691130,LOC107725743,LOC107567893,LOC102790067 coding downstream 1186256 39173324 ~ 39175138 (+)
tspan3 tspan3,tspan3a,LOC107690355 coding downstream 1198154 39185222 ~ 39191405 (+)
G163241 cox5ab,LOC107595344,LOC107713225,LOC103046663,LOC108432642,LOC107665137 non-coding upstream 7953 37964330 ~ 37977105 (+)
G163161 NA non-coding upstream 436765 37548037 ~ 37548293 (+)
G163110 NA non-coding upstream 547009 37437568 ~ 37438049 (+)
G163095 NA non-coding upstream 610853 37374006 ~ 37374205 (+)
G163087 NA non-coding upstream 613210 37366118 ~ 37371848 (+)
G163288 NA non-coding downstream 684214 38671282 ~ 38672233 (+)
G163296 NA non-coding downstream 750651 38737719 ~ 38740775 (+)
G163297 NA non-coding downstream 755727 38742795 ~ 38744936 (+)
G163349 NA non-coding downstream 815900 38802968 ~ 38803188 (+)
G163379 NA non-coding downstream 886340 38873408 ~ 38873855 (+)
G163105 kpyk,LOC103044212,LOC108432067,LOC108264538,LOC106587214 other upstream 573089 37409992 ~ 37411969 (+)
LOC103046025 hcn4,LOC108263998 other upstream 632279 37287167 ~ 37352779 (+)
G162964 LOC108431875,LOC108413582 other upstream 1230371 36754185 ~ 36754687 (+)
ccpg1 ccpg1 other upstream 1815313 36132415 ~ 36169745 (+)
pygo1 pygo1 other upstream 1864656 36112042 ~ 36120402 (+)
reln reln other downstream 1588021 39575089 ~ 39788454 (+)

Expression


Co-expression Network