G163693


Basic Information

Item Value
gene id G163693
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035914.1
NCBI id CM008317.1
chromosome length 41377133
location 39793612 ~ 39794019 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU221686
atttgattgaaaataaactagtaatcaagatattgagatcttttccagctgattttacccccggatcagaggaggactctttgtgggttgttaaccagctttaggatgtgtgttagctagctaagttagctaagttgtgtgtgtagttagcgttagccagctaagttagctaggttatgtgtgtgttagttaactggctaagttagctaggttatgtgtgtgttagttagctagtttaaatgtgtgttagttagctaggttatgtgtgtgttagttaactggctaa

Function

GO: NA

KEGG:

id description
ko00290 Valine, leucine and isoleucine biosynthesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU221686 True 286 lncRNA 0.38 2 39793612 39794019

Neighbor

gene id symbol gene type direction distance location
LOC103038446 LOC108443054,LOC108263931,LOC108265089 coding upstream 301536 39487766 ~ 39492076 (+)
pik3c2a pik3c2a coding upstream 455734 39271936 ~ 39337878 (+)
tspan3 tspan3,tspan3a,LOC107690355 coding upstream 602207 39185222 ~ 39191405 (+)
LOC103046335 ch25hl1.2,LOC108435345,LOC107691130,LOC107725743,LOC107567893,LOC102790067 coding upstream 618474 39173324 ~ 39175138 (+)
LOC111194738 LOC104947953,LOC106536897 coding upstream 698805 39092479 ~ 39094807 (+)
LOC111194742 NA coding downstream 20977 39814996 ~ 39820624 (+)
LOC103034226 NA coding downstream 44018 39838037 ~ 39927918 (+)
LOC103039568 sox9 coding downstream 470644 40264663 ~ 40270386 (+)
LOC103036843 sstr5,LOC108241368,LOC103468864,LOC107083133,LOC106942343,LOC103140984,LOC102219310,LOC106518680 coding downstream 965256 40759275 ~ 40765548 (+)
LOC111194726 sstr5,sstr2,LOC106601899,LOC101075299,LOC106606408 coding downstream 1113122 40907141 ~ 40910721 (+)
G163691 NA non-coding upstream 2825 39790365 ~ 39790787 (+)
G163689 NA non-coding upstream 3555 39789834 ~ 39790057 (+)
G163604 NA non-coding upstream 183580 39609482 ~ 39610032 (+)
G163606 NA non-coding upstream 232267 39554318 ~ 39561345 (+)
G163587 NA non-coding upstream 365008 39427902 ~ 39428604 (+)
LOC111194824 NA non-coding downstream 5021 39799040 ~ 39802192 (+)
G163713 NA non-coding downstream 59360 39853379 ~ 39928814 (+)
G163721 NA non-coding downstream 186373 39980392 ~ 40013363 (+)
G163722 NA non-coding downstream 187370 39981389 ~ 40002482 (+)
G163769 NA non-coding downstream 264323 40058342 ~ 40058608 (+)
reln reln other upstream 5158 39575089 ~ 39788454 (+)
G163105 kpyk,LOC103044212,LOC108432067,LOC108264538,LOC106587214 other upstream 2381643 37409992 ~ 37411969 (+)
LOC103046025 hcn4,LOC108263998 other upstream 2440833 37287167 ~ 37352779 (+)
G162964 LOC108431875,LOC108413582 other upstream 3038925 36754185 ~ 36754687 (+)
ccpg1 ccpg1 other upstream 3623867 36132415 ~ 36169745 (+)

Expression


Co-expression Network