CI01000012_12292583_12371612 (ADK, ADKA)


Basic Information

Item Value
gene id CI01000012_12292583_12371612
gene name ADK, ADKA
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 12292583 ~ 12371612 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000012_12292583_12371612.mRNA
TCTCAGTGGATGATCCAGGAGCCGCACAACGTTGCCACTTTCTTTGGCTGCATCGGGAAGGATAAGTTCGGGAGGATCCTGAAGGAGAAGGCAGAGGAAGCCCACGTGGATGCCCACTACTACGAGCAGAGCGAGGAGCCCACGGGGACCTGCGCTGCCTGCATCACTGGCGACAACAGGTCTCTTGTTGCGAATCTCGCTGCTGCTAATTGCTACAAAAAAGAGAAACACCTCGATCTGGAGGACAACTGGAAGCTTGTTGAGAAAGCCCAAGTTTACTACATCGCTGGGTTCTTCCTGACCGTGTCCTTGGAATCGATCCTGAAGGTAGCCAAACACGCTTCTGAAAACAACAAGTTCTTCTGCTTGAATCTGTCGGCTCCATTTATCTGTGAGTTCTTCAAGGAGCCCCTGCTGAAGGTTATGCCCTATGTGGACATCCTTTTTGGCAACGAGACGGAGGCCGCCGCATTTGCGCGAGCACAAGGCTTTGAGACTGAAGACATTGAGGAGATTGCAAAGTTGGCCCAAAGCTTATCCAAAGTGAACAAGAAAAGGCAGAGGATTGTTGTCTTCACCCAAGGCAAAGAAGGAACTGTAATGACCAAAGGTGACAAGGTGGAGACATTCCCTGTTCTGGAGATTGACCAGAGCGAGATAGTGGACACCAACGGTGCTGGAGACGCCTTTGTTGGAGGTTTCCTGTCTCAGCTGGTACAGGATAAGACCTTTGAGCAGTGCATCCGTGCTGGACACTACGCTGCTAACGTCATTATTCGCCACGCGGGCTGCACATTCCCAGAAAAGCCCGACTTCCAC

Function

symbol description
adka Predicted to enable adenosine kinase activity. Predicted to be involved in AMP salvage. Predicted to act upstream of or within phosphorylation and purine ribonucleoside salvage. Predicted to be active in cytosol and nucleus. Is expressed in several structures, including digestive system; fin; immature eye; nervous system; and periderm. Human ortholog(s) of this gene implicated in hypermethioninemia due to adenosine kinase deficiency. Orthologous to human ADK (adenosine kinase).
adk Enables RNA binding activity. Predicted to be involved in dAMP salvage. Predicted to act upstream of or within dATP biosynthetic process and purine ribonucleoside salvage. Located in cytosol; nucleoplasm; and plasma membrane. Implicated in hypermethioninemia due to adenosine kinase deficiency. Biomarker of temporal lobe epilepsy.

GO:

id name namespace
GO:0016301 kinase activity molecular_function

KEGG:

id description
K00856 E2.7.1.20, ADK; adenosine kinase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000012_12292583_12371612.mRNA True 819 mRNA 0.52 7 12292583 12371612

Neighbor

gene id symbol gene type direction distance location
CI01000012_12270454_12276521 NA coding upstream 15958 12270346 ~ 12276625 (+)
CI01000012_12220568_12234927 NA coding upstream 57320 12219998 ~ 12235263 (+)
CI01000012_12173747_12212480 VCLA, VCL coding upstream 79298 12173388 ~ 12213285 (+)
CI01000012_12159352_12162539 NA coding upstream 129744 12158648 ~ 12162839 (+)
CI01000012_12128962_12130578 ITPRIP coding upstream 160456 12128446 ~ 12132127 (+)
CI01000012_12378120_12378419 NA coding downstream 6508 12378120 ~ 12378662 (+)
CI01000012_12381049_12417489 KAT6B coding downstream 8580 12380192 ~ 12418697 (+)
CI01000012_12440074_12465741 SLKA, SLKB, SLK coding downstream 68462 12440074 ~ 12466032 (+)
CI01000012_12489485_12490402 NA coding downstream 117675 12489287 ~ 12490431 (+)
CI01000012_12505469_12509093 ERLIN1, ERLIN2 coding downstream 133857 12505469 ~ 12509316 (+)
G76318 NA non-coding upstream 124128 12168168 ~ 12168455 (+)
G76316 NA non-coding upstream 127351 12164961 ~ 12165232 (+)
G76315 NA non-coding upstream 128172 12164183 ~ 12164411 (+)
G76306 NA non-coding upstream 181937 12110427 ~ 12110646 (+)
G76299 NA non-coding upstream 215459 12076910 ~ 12077124 (+)
G76327 NA non-coding downstream 61287 12432899 ~ 12433158 (+)
G76222 NA non-coding downstream 62057 12433669 ~ 12435061 (+)
G76230 NA non-coding downstream 64419 12436031 ~ 12436325 (+)
G76244 NA non-coding downstream 65500 12437112 ~ 12437490 (+)
G76328 NA non-coding downstream 66082 12437694 ~ 12437915 (+)
G75533 NA other upstream 1146844 11144817 ~ 11145739 (+)
CI01000012_10223957_10235955 NA other upstream 2068296 10223697 ~ 10236276 (+)
G73578 NA other upstream 3924956 8366806 ~ 8367627 (+)
CI01000012_07806089_07811902 BEND3 other upstream 4484728 7805248 ~ 7811902 (+)
CI01000012_05923216_05928055 SRD5A2B other upstream 6368278 5922385 ~ 5929186 (+)
G76385 NA other downstream 259143 12630755 ~ 12675666 (+)
G76374 NA other downstream 373919 12745531 ~ 12749169 (+)
CI01000012_13029637_13033226 RGS17 other downstream 643894 13029435 ~ 13038899 (+)
G76645 NA other downstream 1280247 13651859 ~ 13652234 (+)
G76656 NA other downstream 1331875 13703487 ~ 13739731 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location