G68508


Basic Information

Item Value
gene id G68508
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 111775 ~ 112166 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU78049
TGAAGACACCTGGTGCCACACTCTAATCAGCTAATTAACTCAAAACACCTGCAAAGGCCTTTAAATGGTCTCTCAGTCTAGTTCTGTAGGCTACACAATCATGGGGAAGACTGCTGACTTGACAGTTGTCCAAAAGACGACCATTGACACCTTGCACAAGGAGGGCAAGACACAAAAGGTCATTGCAAAAGAGGCTGGCTGTTCACAGAGCTCTGTGTCCAAGCACATTAATAGAGAGGCGAAGAGAAGGAAAAGATGTGGTAGAAAAAAGTGTACAAGCAATAGGGATAACCGCACCCTGGAGAGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU78049 True 308 lncRNA 0.46 2 111775 112166

Neighbor

gene id symbol gene type direction distance location
CI01000012_00095178_00097740 NA coding downstream 14035 94665 ~ 97740 (-)
CI01000012_00074656_00075480 NA coding downstream 36012 74585 ~ 75763 (-)
CI01000012_00017728_00018696 NA coding downstream 90983 17390 ~ 20792 (-)
CI01000012_00176813_00177864 NA coding upstream 64462 176344 ~ 177926 (-)
CI01000012_00178282_00181473 NA coding upstream 66016 178182 ~ 183012 (-)
CI01000012_00223417_00223713 NA coding upstream 111049 223215 ~ 224149 (-)
CI01000012_00260363_00261340 HCAR1-3 coding upstream 148130 260296 ~ 261508 (-)
CI01000012_00340814_00363240 HAAO coding upstream 228499 340665 ~ 363240 (-)
G68489 NA non-coding downstream 86308 25170 ~ 25467 (-)
G68543 NA non-coding upstream 79982 192148 ~ 197284 (-)
G68547 NA non-coding upstream 94114 206280 ~ 211322 (-)
G68555 NA non-coding upstream 136346 248512 ~ 248805 (-)
G68560 NA non-coding upstream 157652 269818 ~ 270043 (-)
G69150 NA other upstream 453297 565463 ~ 566956 (-)
G69161 NA other upstream 475438 587604 ~ 588015 (-)
G69277 NA other upstream 617754 729920 ~ 730465 (-)
G69332 NA other upstream 663198 775364 ~ 775879 (-)

Expression


Co-expression Network