G177940


Basic Information

Item Value
gene id G177940
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 20100576 ~ 20100802 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU241057
aaaagatgctgtaccagctaagctgcgtcttcagtaacgtctcggacttcactatgtgtacaaaggacaataagtggcaaacaaggcgttttgtgaagcagaacttttaataatatgcacacaaccgtggcaatcacaggtaataaacataacttacttttcagaagcttgtttgccacttattgtcctttgtatacagctggtacagcatcttttaaggtcccccg

Function

GO:

id name namespace
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU241057 True 227 lncRNA 0.41 1 20100576 20100802

Neighbor

gene id symbol gene type direction distance location
pum3 pum3,k0020,LOC107705054,LOC107742987 coding upstream 167756 19919877 ~ 19932820 (+)
LOC103023409 co-prmt,LOC108428880 coding upstream 181599 19896737 ~ 19918977 (+)
erbin erbin,erbb2ip,LOC107667260,LOC107726559,LOC107705051,LOC107742960 coding upstream 449158 19594101 ~ 19651418 (+)
nln nln,LOC107705053,LOC107667266,LOC107548669 coding upstream 578503 19503557 ~ 19522073 (+)
trappc13 trappc13,LOC107667267 coding upstream 625399 19459956 ~ 19475177 (+)
LOC103030097 NA coding downstream 48456 20149258 ~ 20150118 (+)
LOC103027562 NA coding downstream 51659 20152461 ~ 20155315 (+)
smad2 smad2,LOC107743055,LOC107653131 coding downstream 128725 20229527 ~ 20257745 (+)
skor2 skor2,LOC107743073,LOC107653123,LOC107738854,LOC107558682 coding downstream 280887 20381689 ~ 20395156 (+)
hdhd2 hdhd2,LOC107738843,LOC107743237 coding downstream 302692 20403494 ~ 20407568 (+)
G177885 NA non-coding upstream 105409 19990644 ~ 19995167 (+)
LOC111195063 NA non-coding upstream 145102 19949596 ~ 19955474 (+)
G177861 NA non-coding upstream 209863 19890267 ~ 19890713 (+)
LOC107197765 NA non-coding upstream 224186 19875366 ~ 19876390 (+)
G177830 NA non-coding upstream 267466 19795144 ~ 19833110 (+)
LOC111195064 NA non-coding downstream 4532 20105334 ~ 20123848 (+)
G177955 NA non-coding downstream 57045 20157847 ~ 20163869 (+)
G177976 NA non-coding downstream 70483 20171285 ~ 20173721 (+)
G177995 NA non-coding downstream 98962 20199764 ~ 20203551 (+)
G177984 NA non-coding downstream 135415 20236217 ~ 20240919 (+)
LOC103043854 NA other upstream 3865 20089238 ~ 20096711 (+)
LOC103042206 LOC108428882 other upstream 324785 19750942 ~ 19775791 (+)
LOC111194983 NA other upstream 378016 19720301 ~ 19722560 (+)
LOC103024155 si:dkey-81j8.6,LOC108440140,LOC107720718,LOC107572716,LOC107678005,LOC105904646 other upstream 1542132 18539898 ~ 18558444 (+)
LOC103047412 golga7,LOC108276767,LOC107553707,LOC107687624,LOC107678053,LOC107586122 other upstream 1770087 18324873 ~ 18330489 (+)
G177950 NA other downstream 38020 20138822 ~ 20139564 (+)
ier3ip1 ier3ip1,LOC106633120 other downstream 295575 20396377 ~ 20399165 (+)
LOC103046694 LOC108440723,LOC108277161 other downstream 2026319 22127121 ~ 22315307 (+)
LOC103025565 scd5 other downstream 2355517 22456319 ~ 22465729 (+)
hnrnpdl hnrnpdl,LOC107715891,LOC107702595,LOC107653490 other downstream 2386021 22486823 ~ 22491503 (+)

Expression


Co-expression Network