G68476


Basic Information

Item Value
gene id G68476
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 319929 ~ 320342 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU78015
TTACACACACGGCTGTAGCCAATCACACACCCTACATAAGCCATGGACTTCCTCTCTCTCATGGCCGAGTATCGTTTAGTGTTTATGCTGTTTAGCGTAGCTATTTTACGGAGCCTGTTCCCAGTCCTTGTTTGAGTTTCTAGTTCTAGTCAAAGTCTAGTCACATCTAGTCATGTCTTTTTTTCTGATTGCCTGTTTCCTGATTACCTGCCTGTCTTGGACTTCTCTCTTGCCTTGCCCTTTGGACTCTGTTTGCACCTCTCTTGGACTATTGCCTGTTTCCCCTGGACTATTCTTTAGCCTAGCCCTCCTGGATGCTGTTTGCCACAGAACGACCACGCTTGTTCCTGGATTACTCTTCTGTCTTGCCCTTTAAATATCTGAATGCCATTGTCAGACCCTTGCCTGTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU78015 True 414 lncRNA 0.46 1 319929 320342

Neighbor

gene id symbol gene type direction distance location
CI01000012_00260363_00261340 HCAR1-3 coding downstream 58421 260296 ~ 261508 (-)
CI01000012_00223417_00223713 NA coding downstream 95780 223215 ~ 224149 (-)
CI01000012_00178282_00181473 NA coding downstream 136917 178182 ~ 183012 (-)
CI01000012_00176813_00177864 NA coding downstream 142003 176344 ~ 177926 (-)
CI01000012_00095178_00097740 NA coding downstream 222189 94665 ~ 97740 (-)
CI01000012_00340814_00363240 HAAO coding upstream 20323 340665 ~ 363240 (-)
CI01000012_00382850_00384215 NA coding upstream 61369 381711 ~ 384426 (-)
CI01000012_00427641_00472235 NA coding upstream 107231 427573 ~ 472577 (-)
CI01000012_00520655_00552630 NA coding upstream 199797 520139 ~ 553820 (-)
CI01000012_00647774_00648451 NA coding upstream 327244 647586 ~ 648945 (-)
G68569 NA non-coding downstream 148 319483 ~ 319781 (-)
G68561 NA non-coding downstream 812 318428 ~ 319117 (-)
G68568 NA non-coding downstream 2761 316940 ~ 317168 (-)
G68567 NA non-coding downstream 5019 313923 ~ 314910 (-)
G68463 NA non-coding downstream 10836 308765 ~ 309093 (-)
G68571 NA non-coding upstream 5293 325635 ~ 325885 (-)
G68582 NA non-coding upstream 71419 391761 ~ 392241 (-)
G68585 NA non-coding upstream 78229 398571 ~ 398906 (-)
G68587 NA non-coding upstream 81188 401530 ~ 408635 (-)
G68588 NA non-coding upstream 92694 413036 ~ 413300 (-)
G69150 NA other upstream 245121 565463 ~ 566956 (-)
G69161 NA other upstream 267262 587604 ~ 588015 (-)
G69277 NA other upstream 409578 729920 ~ 730465 (-)
G69332 NA other upstream 455022 775364 ~ 775879 (-)
CI01000012_01139864_01192154 TTC7A other upstream 815334 1135676 ~ 1192154 (-)

Expression


Co-expression Network