G178233


Basic Information

Item Value
gene id G178233
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 21699433 ~ 21699633 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU241453
cagaggttacactagctgttacatttaaataatggaggtagaattacagtatattagaaaaaaacgtgattgaaagttgtctgttttgccattgaaacctatggggatgggtggagttacacagctttctgaaactgaacagcagggggcgcccgacctgtggtggcttcacttttgagagacgatgctctgtccagctat

Function

GO:

id name namespace
GO:0019222 regulation of metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0019538 protein metabolic process biological_process
GO:0030162 regulation of proteolysis biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:0051246 regulation of protein metabolic process biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0050817 coagulation biological_process
GO:0008236 serine-type peptidase activity molecular_function
GO:0017171 serine hydrolase activity molecular_function

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU241453 True 201 lncRNA 0.43 1 21699433 21699633

Neighbor

gene id symbol gene type direction distance location
musk musk coding upstream 330159 21326212 ~ 21369274 (+)
cst8 NA coding upstream 403584 21285246 ~ 21295849 (+)
LOC103023250 NA coding upstream 440846 21203262 ~ 21258587 (+)
LOC103022731 cntfr,LOC107554853,LOC107756542,LOC107738850,LOC107554231 coding upstream 521975 20842037 ~ 21177458 (+)
galt galt,LOC107653127,LOC107667272 coding upstream 1120648 20428762 ~ 20578785 (+)
grin3a grin3a,LOC107750958,LOC107710005,LOC107702562,LOC107554227,LOC104941214 coding downstream 232698 21932331 ~ 21964708 (+)
LOC103047607 LOC103047607 coding downstream 623087 22322720 ~ 22334543 (+)
sec31a sec31a coding downstream 721729 22421362 ~ 22453611 (+)
tmem150c tmem150c,LOC107558260 coding downstream 768804 22468437 ~ 22476305 (+)
LOC103022635 mat2al,LOC108440739,LOC108276530,LOC107732036,LOC107653488,LOC107573852,LOC102202437 coding downstream 810255 22509888 ~ 22515585 (+)
G178202 NA non-coding upstream 152465 21540577 ~ 21546968 (+)
G178105 NA non-coding upstream 434449 21237139 ~ 21264984 (+)
G178108 NA non-coding upstream 740950 20931781 ~ 20958483 (+)
G178097 NA non-coding upstream 978042 20721073 ~ 20721391 (+)
G178091 NA non-coding upstream 1074405 20624779 ~ 20625028 (+)
G178254 NA non-coding downstream 273081 21972714 ~ 21973034 (+)
G178278 NA non-coding downstream 399686 22099319 ~ 22099558 (+)
G178280 NA non-coding downstream 400407 22100040 ~ 22101283 (+)
G178282 NA non-coding downstream 403116 22102749 ~ 22103046 (+)
G178289 NA non-coding downstream 613537 22313170 ~ 22314294 (+)
ier3ip1 ier3ip1,LOC106633120 other upstream 1300268 20396377 ~ 20399165 (+)
G177950 NA other upstream 1559869 20138822 ~ 20139564 (+)
LOC103043854 NA other upstream 1602722 20089238 ~ 20096711 (+)
LOC103042206 LOC108428882 other upstream 1923642 19750942 ~ 19775791 (+)
LOC111194983 NA other upstream 1976873 19720301 ~ 19722560 (+)
LOC103046694 LOC108440723,LOC108277161 other downstream 427488 22127121 ~ 22315307 (+)
LOC103025565 scd5 other downstream 756686 22456319 ~ 22465729 (+)
hnrnpdl hnrnpdl,LOC107715891,LOC107702595,LOC107653490 other downstream 787190 22486823 ~ 22491503 (+)
LOC103022948 hnrnpd,LOC108440733,LOC108276832,LOC107702593 other downstream 793807 22493440 ~ 22502159 (+)
G178352 NA other downstream 845007 22544640 ~ 22546130 (+)

Expression


Co-expression Network