G178368 (tln1)


Basic Information

Item Value
gene id G178368
gene name tln1
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 22604995 ~ 22605572 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU241641
CCTGCACGGTGACAGCGATGGCCTTTGCCGTCTTCACCATAGTAGTCTGGTAATCCACAAAGCTTCCCTCAGGCTCCACTGCCTGGTCCTCCATCCTGTTGATGGCCTGAGTGATGGTATCAACCATGCCACCCACAGCTCCTGCTGCGCCGGCTGCTTCGGTCAGTGTACCGCCCAGGTCGTCCACTGCCTCCTTCATCATCTGTACAGCTTCCTCCAGAGCCTCCTGGGTGTGGGCCGCCTTCGGGTTTCCTCCTGCTTCTTTGGCTGTGTAAAGAATTTGTAAGGCTGATTCCGCTAGAGTCTTGGTCTGGTCCAGCACACTCATCTGCTGCTGGCTGTTTAAGATCTTTGAGGCTGTTCCAATG

Function

symbol description
tln1 Predicted to enable integrin binding activity. Acts upstream of or within animal organ development and sarcomere organization. Predicted to be located in several cellular components, including cytoplasm; cytoskeleton; and ruffle. Predicted to be active in focal adhesion and plasma membrane. Is expressed in several structures, including adaxial cell; cardiovascular system; cranium; musculature system; and nervous system. Orthologous to human TLN1 (talin 1).

NR:

description
PREDICTED: talin-1 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU241641 True 368 lncRNA 0.56 2 22604995 22605572

Neighbor

gene id symbol gene type direction distance location
LOC111195066 NA coding upstream 76912 22519419 ~ 22528083 (+)
LOC103022635 mat2al,LOC108440739,LOC108276530,LOC107732036,LOC107653488,LOC107573852,LOC102202437 coding upstream 89410 22509888 ~ 22515585 (+)
tmem150c tmem150c,LOC107558260 coding upstream 128690 22468437 ~ 22476305 (+)
sec31a sec31a coding upstream 151384 22421362 ~ 22453611 (+)
LOC103047607 LOC103047607 coding upstream 270452 22322720 ~ 22334543 (+)
ankrd55 ankrd55,LOC107670032,LOC107737049,LOC107702571 coding downstream 233936 22839508 ~ 22863383 (+)
il6st NA coding downstream 259569 22865141 ~ 22880314 (+)
slc38a9 slc38a9,LOC107670042,LOC107564110,LOC107740785,LOC107566906,LOC107715861 coding downstream 303221 22908793 ~ 22928244 (+)
LOC111194992 NA coding downstream 359421 22964993 ~ 22966528 (+)
LOC111194985 NA coding downstream 364850 22970422 ~ 22973005 (+)
G178344 NA non-coding upstream 80922 22516531 ~ 22524073 (+)
G178320 NA non-coding upstream 208798 22391198 ~ 22396197 (+)
G178310 NA non-coding upstream 218334 22339979 ~ 22386661 (+)
LOC111195069 NA non-coding upstream 223417 22380610 ~ 22381578 (+)
G178289 NA non-coding upstream 290701 22313170 ~ 22314294 (+)
G178381 tln1 non-coding downstream 24339 22629911 ~ 22671830 (+)
G178392 map3k1,LOC107670047 non-coding downstream 102176 22707748 ~ 22708401 (+)
G178394 map3k1 non-coding downstream 108165 22713737 ~ 22720806 (+)
G178472 NA non-coding downstream 324651 22930223 ~ 22930945 (+)
G178474 NA non-coding downstream 329911 22935483 ~ 22941621 (+)
G178352 NA other upstream 58865 22544640 ~ 22546130 (+)
LOC103022948 hnrnpd,LOC108440733,LOC108276832,LOC107702593 other upstream 102836 22493440 ~ 22502159 (+)
hnrnpdl hnrnpdl,LOC107715891,LOC107702595,LOC107653490 other upstream 113492 22486823 ~ 22491503 (+)
LOC103025565 scd5 other upstream 139266 22456319 ~ 22465729 (+)
LOC103046694 LOC108440723,LOC108277161 other upstream 289688 22127121 ~ 22315307 (+)
G178388 hmgcs1,LOC108427280,LOC108277226,LOC107737058 other downstream 83429 22689001 ~ 22709557 (+)
G178485 NA other downstream 357875 22963447 ~ 22964989 (+)
LOC103032894 LOC108424565 other downstream 1842220 24447792 ~ 24454622 (+)
smpd1 smpd1,LOC107718723,LOC107720657,LOC107556869 other downstream 2638589 25244161 ~ 25257469 (+)
LOC103024073 LOC108424537 other downstream 4225065 26830637 ~ 26879083 (+)

Expression


Co-expression Network