G178392 (map3k1,LOC107670047)


Basic Information

Item Value
gene id G178392
gene name map3k1,LOC107670047
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 22707748 ~ 22708401 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU241669
GTACCCGTACCTCTCCACTTGGTTCTGTGGCTGTCCACAGTCTGAGGCTGAGACAATATGAGGGTAGAATTCAGCTGGGAACTCCAGCAGCAGTCTGTCGATCAGGCAAAGGCGGCCCAGCAGAGCCTGCCAGTTATTGGATTCAGTCTGCGAGCCCAGGATACAATTCAGCACATAGTCCACTCCACCGATGCCAATAGATCCAGCTTTGAGGATCTCTCTACCCA

Function

symbol description
map3k1 Predicted to enable ATP binding activity; protein kinase activity; and zinc ion binding activity. Predicted to act upstream of or within protein phosphorylation. Human ortholog(s) of this gene implicated in 46,XY sex reversal 6 and breast cancer. Orthologous to human MAP3K1 (mitogen-activated protein kinase kinase kinase 1).

NR:

description
PREDICTED: mitogen-activated protein kinase kinase kinase 1 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU241669 True 227 lncRNA 0.53 2 22707748 22708401

Neighbor

gene id symbol gene type direction distance location
LOC111195066 NA coding upstream 179665 22519419 ~ 22528083 (+)
LOC103022635 mat2al,LOC108440739,LOC108276530,LOC107732036,LOC107653488,LOC107573852,LOC102202437 coding upstream 192163 22509888 ~ 22515585 (+)
tmem150c tmem150c,LOC107558260 coding upstream 231443 22468437 ~ 22476305 (+)
sec31a sec31a coding upstream 254137 22421362 ~ 22453611 (+)
LOC103047607 LOC103047607 coding upstream 373205 22322720 ~ 22334543 (+)
ankrd55 ankrd55,LOC107670032,LOC107737049,LOC107702571 coding downstream 131107 22839508 ~ 22863383 (+)
il6st NA coding downstream 156740 22865141 ~ 22880314 (+)
slc38a9 slc38a9,LOC107670042,LOC107564110,LOC107740785,LOC107566906,LOC107715861 coding downstream 200392 22908793 ~ 22928244 (+)
LOC111194992 NA coding downstream 256592 22964993 ~ 22966528 (+)
LOC111194985 NA coding downstream 262021 22970422 ~ 22973005 (+)
G178381 tln1 non-coding upstream 35918 22629911 ~ 22671830 (+)
G178368 tln1 non-coding upstream 102176 22604995 ~ 22605572 (+)
G178344 NA non-coding upstream 183675 22516531 ~ 22524073 (+)
G178320 NA non-coding upstream 311551 22391198 ~ 22396197 (+)
G178310 NA non-coding upstream 321087 22339979 ~ 22386661 (+)
G178394 map3k1 non-coding downstream 5336 22713737 ~ 22720806 (+)
G178472 NA non-coding downstream 221822 22930223 ~ 22930945 (+)
G178474 NA non-coding downstream 227082 22935483 ~ 22941621 (+)
G178476 NA non-coding downstream 232203 22940604 ~ 22941149 (+)
G178477 NA non-coding downstream 234725 22943126 ~ 22943349 (+)
G178352 NA other upstream 161618 22544640 ~ 22546130 (+)
LOC103022948 hnrnpd,LOC108440733,LOC108276832,LOC107702593 other upstream 205589 22493440 ~ 22502159 (+)
hnrnpdl hnrnpdl,LOC107715891,LOC107702595,LOC107653490 other upstream 216245 22486823 ~ 22491503 (+)
LOC103025565 scd5 other upstream 242019 22456319 ~ 22465729 (+)
LOC103046694 LOC108440723,LOC108277161 other upstream 392441 22127121 ~ 22315307 (+)
G178485 NA other downstream 255046 22963447 ~ 22964989 (+)
LOC103032894 LOC108424565 other downstream 1739391 24447792 ~ 24454622 (+)
smpd1 smpd1,LOC107718723,LOC107720657,LOC107556869 other downstream 2535760 25244161 ~ 25257469 (+)
LOC103024073 LOC108424537 other downstream 4122236 26830637 ~ 26879083 (+)
rnasek rnasek,LOC107554319 other downstream 4205349 26913750 ~ 26916344 (+)

Expression


Co-expression Network