G178623 (wrn)


Basic Information

Item Value
gene id G178623
gene name wrn
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 23425155 ~ 23426497 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU241999
GGGGTCTTGCATCTTGATTTCTCGGCACATAAGCTCTTGGGCACAGGTCTATGTTGGGCTGCAGCAGGAGGGTCCTGTGTTTCTCGTCTTTAGCACTGTTTAACCATGATCTTCCCTTGGGGGTGAGTTTGCAGAGAGTACTGAATTTATTAAAGCCAGTGGTCTCCATTAAGTACTTCTCACTGATGAGCTCACGGCCCAGAGCTTTCCACCAGGGTTCAGACACACTCCTCCCCGCCCCAAACAACGGGTTCTTCCGGAA

Function

symbol description
wrn Predicted to enable 3'-5' DNA helicase activity and four-way junction helicase activity. Predicted to be involved in chromosome organization; double-strand break repair via homologous recombination; and multicellular organism aging. Predicted to act upstream of or within DNA replication and nucleobase-containing compound metabolic process. Predicted to be active in chromosome; cytoplasm; and nucleoplasm. Human ortholog(s) of this gene implicated in Werner syndrome; breast cancer; coronary artery disease (multiple); diffuse scleroderma; and senile cataract. Orthologous to human WRN (WRN RecQ like helicase).

NR:

description
PREDICTED: Werner syndrome ATP-dependent helicase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU241999 True 262 lncRNA 0.51 3 23425155 23426497

Neighbor

gene id symbol gene type direction distance location
fut10 fut10 coding upstream 207897 23203476 ~ 23217258 (+)
LOC103038592 LOC106571427,LOC108427269,LOC108276947 coding upstream 237931 22995089 ~ 23187224 (+)
LOC111194985 NA coding upstream 452150 22970422 ~ 22973005 (+)
LOC111194992 NA coding upstream 458627 22964993 ~ 22966528 (+)
slc38a9 slc38a9,LOC107670042,LOC107564110,LOC107740785,LOC107566906,LOC107715861 coding upstream 496911 22908793 ~ 22928244 (+)
purg NA coding downstream 32871 23459368 ~ 23461975 (+)
LOC111188215 NA coding downstream 53040 23479537 ~ 23494300 (+)
LOC103034079 NA coding downstream 67657 23494154 ~ 23497618 (+)
ppp2cb ppp2cb,LOC107758729 coding downstream 76810 23503307 ~ 23514711 (+)
LOC103037096 LOC108410414,LOC108277158,LOC105901021,LOC106603263 coding downstream 115353 23541850 ~ 23690355 (+)
G178617 NA non-coding upstream 6812 23411105 ~ 23418343 (+)
G178616 NA non-coding upstream 21421 23402970 ~ 23403734 (+)
G178614 NA non-coding upstream 27920 23397023 ~ 23397235 (+)
LOC111195072 NA non-coding upstream 77139 23274449 ~ 23348016 (+)
G178578 NA non-coding upstream 161875 23260571 ~ 23263280 (+)
G178624 wrn,LOC107715857,LOC107573262 non-coding downstream 888 23427385 ~ 23432711 (+)
G178611 NA non-coding downstream 20592 23447089 ~ 23475205 (+)
G178632 NA non-coding downstream 73346 23499843 ~ 23500341 (+)
G178635 NA non-coding downstream 89078 23515575 ~ 23515901 (+)
G178634 NA non-coding downstream 89814 23516311 ~ 23519214 (+)
G178485 NA other upstream 460166 22963447 ~ 22964989 (+)
G178388 hmgcs1,LOC108427280,LOC108277226,LOC107737058 other upstream 715598 22689001 ~ 22709557 (+)
G178352 NA other upstream 879025 22544640 ~ 22546130 (+)
LOC103022948 hnrnpd,LOC108440733,LOC108276832,LOC107702593 other upstream 922996 22493440 ~ 22502159 (+)
hnrnpdl hnrnpdl,LOC107715891,LOC107702595,LOC107653490 other upstream 933652 22486823 ~ 22491503 (+)
LOC103032894 LOC108424565 other downstream 1021295 24447792 ~ 24454622 (+)
smpd1 smpd1,LOC107718723,LOC107720657,LOC107556869 other downstream 1817664 25244161 ~ 25257469 (+)
LOC103024073 LOC108424537 other downstream 3404140 26830637 ~ 26879083 (+)
rnasek rnasek,LOC107554319 other downstream 3487253 26913750 ~ 26916344 (+)
LOC103038954 zgc:101846,LOC106525086,LOC108416226,LOC101161532 other downstream 4097805 27524302 ~ 27525441 (+)

Expression


Co-expression Network