G68409


Basic Information

Item Value
gene id G68409
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 433521 ~ 433762 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU77943
TCCCAGTTAGCTCTCCAGTCTCTGTTCCTGTTCACTAGTGATGGCAGAGGTATGTTGGCCGCAATGTGTGCTGCTACGCCGCTAGAGGGGCGAGACGCGGCCGCAGCGTTATCAGCGTCCATAATCGAAGAGATGGTCAGAATCAGCACCTACAGTGTAAACATAAAGATGTACACGCCAGGCATCTTCTGACACCATGTTTATGCAGCAATCTAAGCATAAAATAAAAGGCAGACATGCGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU77943 True 242 lncRNA 0.50 1 433521 433762

Neighbor

gene id symbol gene type direction distance location
CI01000012_00318129_00318595 NA coding upstream 114103 318129 ~ 319418 (+)
CI01000012_00194370_00195347 HCAR1-3 coding upstream 237845 193903 ~ 195676 (+)
CI01000012_00030966_00032941 NA coding upstream 400466 28818 ~ 33055 (+)
CI01000012_00502185_00516358 NA coding downstream 66389 500151 ~ 516908 (+)
CI01000012_00593086_00594741 NA coding downstream 158364 592126 ~ 595465 (+)
CI01000012_00644021_00646785 NA coding downstream 210259 644021 ~ 647075 (+)
CI01000012_00886127_00889703 NA coding downstream 451358 885120 ~ 890337 (+)
CI01000012_00979848_00986445 NA coding downstream 546086 979848 ~ 986745 (+)
G68402 NA non-coding upstream 17462 415588 ~ 416059 (+)
G68397 NA non-coding upstream 37385 395869 ~ 396136 (+)
G68395 NA non-coding upstream 41452 391754 ~ 392069 (+)
G68272 NA non-coding upstream 88463 344660 ~ 345058 (+)
G68373 NA non-coding upstream 117856 315371 ~ 315665 (+)
G68410 NA non-coding downstream 2127 435889 ~ 436368 (+)
G68416 NA non-coding downstream 24236 457998 ~ 458724 (+)
G68425 NA non-coding downstream 47982 481744 ~ 481952 (+)
G68429 NA non-coding downstream 55537 489299 ~ 489657 (+)
G68450 NA non-coding downstream 83923 517685 ~ 517894 (+)
G68282 NA other upstream 372989 26390 ~ 60532 (+)
G68660 NA other downstream 101804 535566 ~ 535953 (+)
G68725 NA other downstream 249761 683523 ~ 684856 (+)
G70029 NA other downstream 2188716 2622478 ~ 2631385 (+)
CI01000012_04424569_04425090 NA other downstream 3986477 4424569 ~ 4425756 (+)

Expression


Co-expression Network