G68617


Basic Information

Item Value
gene id G68617
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 460844 ~ 461061 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU78184
AATTTATTTAATACACGAGTTCCACAATTTGAGTTGAATTTCTGAAATAAATGAACTTTTCCACAACATTCTAATTTATTGAGATGCACCTGTATTTACATGGGTTGCAACTCGTGGTGAGAGATTACTCAAAACTGTGCATGCGTCGAATGCCTGAGAACGCATACAAGCCAAGTGAAGTATACTTTGCAAAGCTGTGTGTATGCGTAGAAAAAAAC

Function

NR:

description
leucine-rich repeat flightless-interacting protein 2 isoform X11

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU78184 True 218 lncRNA 0.36 1 460844 461061

Neighbor

gene id symbol gene type direction distance location
CI01000012_00382850_00384215 NA coding downstream 76418 381711 ~ 384426 (-)
CI01000012_00340814_00363240 HAAO coding downstream 97604 340665 ~ 363240 (-)
CI01000012_00260363_00261340 HCAR1-3 coding downstream 199336 260296 ~ 261508 (-)
CI01000012_00223417_00223713 NA coding downstream 236695 223215 ~ 224149 (-)
CI01000012_00178282_00181473 NA coding downstream 277832 178182 ~ 183012 (-)
CI01000012_00520655_00552630 NA coding upstream 59078 520139 ~ 553820 (-)
CI01000012_00647774_00648451 NA coding upstream 186525 647586 ~ 648945 (-)
CI01000012_00686760_00686993 NA coding upstream 225460 686521 ~ 686993 (-)
CI01000012_00689933_00695237 NA coding upstream 228033 689094 ~ 695264 (-)
CI01000012_00863269_00864644 NA coding upstream 400979 862040 ~ 865072 (-)
G68616 NA non-coding downstream 619 459986 ~ 460225 (-)
G68609 NA non-coding downstream 8672 451971 ~ 452172 (-)
G68604 NA non-coding downstream 21093 439483 ~ 439751 (-)
G68602 NA non-coding downstream 23304 437262 ~ 437540 (-)
G68600 NA non-coding downstream 24255 436371 ~ 436589 (-)
G68627 NA non-coding upstream 27381 488442 ~ 489050 (-)
G68628 NA non-coding upstream 28193 489254 ~ 489577 (-)
G68636 NA non-coding upstream 37772 498833 ~ 499081 (-)
G68638 NA non-coding upstream 40361 501422 ~ 501948 (-)
G68639 NA non-coding upstream 42533 503594 ~ 503802 (-)
G69150 NA other upstream 104402 565463 ~ 566956 (-)
G69161 NA other upstream 126543 587604 ~ 588015 (-)
G69277 NA other upstream 268859 729920 ~ 730465 (-)
G69332 NA other upstream 314303 775364 ~ 775879 (-)
CI01000012_01139864_01192154 TTC7A other upstream 674615 1135676 ~ 1192154 (-)

Expression


Co-expression Network