G180092


Basic Information

Item Value
gene id G180092
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 30563822 ~ 30564737 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU243962
tttcaggagtttattaaagatagcgagagattctcctgatctggtagtagaaggtagttagttagaggtgttaggagagtaagaactctttgaagagctctgtcttcaggagtttattaaagatagtgagagattctcctgatctggtagtagaaggtagttagttagaggtgttaggagagtagtttgttccaccattggggaactctgtatgagaacagtctggattgctttgtgt
>TU243963
ttaaagatagcgagagattctcctgatctggtagtagaaggtagttagttagaggtgttaggagagtaagtgctctttgaagagctctgtcttcaggagtttattaaagatagcgagagattctcctgatctggtagtagaaggtagttagttagaggtgttaggagagtagtttgttccaccattggggaactctgtatgagaacagtctggattgctttgtgt

Function

GO: NA

KEGG:

id description
ko00830 Retinol metabolism
ko00980 Metabolism of xenobiotics by cytochrome P450
ko00982 Drug metabolism - cytochrome P450
ko05204 Chemical carcinogenesis - DNA adducts

RNA

RNA id representative length rna type GC content exon number start site end site
TU243962 True 238 lncRNA 0.40 2 30563822 30564340
TU243963 False 225 lncRNA 0.41 3 30563822 30564737

Neighbor

gene id symbol gene type direction distance location
cblb cblb,LOC107693962,LOC107576804,LOC107747038 coding downstream 144736 30279096 ~ 30419086 (-)
picalm picalm,LOC107744613 coding downstream 935423 29572654 ~ 29628399 (-)
robo3 robo3,LOC107751391,LOC107577175 coding downstream 1199546 29159040 ~ 29364276 (-)
pknox2 pknox2,LOC107691639,LOC106567647,LOC106603668 coding downstream 1565383 28954039 ~ 28998439 (-)
panx3 panx3,LOC107747045,LOC107686209,LOC107589683,LOC107579026,LOC107691702 coding downstream 1613906 28939591 ~ 28949916 (-)
crybg3 NA coding upstream 113034 30677771 ~ 30733688 (-)
hlcs hlcs coding upstream 236782 30801519 ~ 30848802 (-)
pigp NA coding upstream 293020 30857757 ~ 30875590 (-)
dscr3 dscr3 coding upstream 361431 30926168 ~ 30932814 (-)
kcnj6 kcnj6,LOC107690833,LOC107747353 coding upstream 407743 30972480 ~ 31057287 (-)
G180086 NA non-coding downstream 15798 30541824 ~ 30548024 (-)
G180077 NA non-coding downstream 86813 30476450 ~ 30477009 (-)
G180056 NA non-coding downstream 249179 30313315 ~ 30314643 (-)
G180045 NA non-coding downstream 285212 30276867 ~ 30278610 (-)
G180046 NA non-coding downstream 288104 30274739 ~ 30275718 (-)
G180122 NA non-coding upstream 12568 30577305 ~ 30578205 (-)
G180196 NA non-coding upstream 325931 30890668 ~ 30907924 (-)
G180197 NA non-coding upstream 346713 30911450 ~ 30919603 (-)
G180217 NA non-coding upstream 474279 31039016 ~ 31066380 (-)
G180231 NA non-coding upstream 533294 31098031 ~ 31098497 (-)
G179816 NA other downstream 1712717 28850690 ~ 28851105 (-)
G179578 LOC108423781,LOC107751398,LOC107693988,LOC107577128,LOC107691633,LOC107588586 other downstream 2997130 27561845 ~ 27566692 (-)
G179583 zgc:101846,LOC106525086,LOC108416226,LOC101161532 other downstream 3038434 27524328 ~ 27525388 (-)
LOC103038646 zgc:194989,hist2h2l,LOC107719244,LOC107667924,LOC107574861,LOC108277172,LOC105900366,LOC103356012 other downstream 3039687 27523131 ~ 27524135 (-)
ift46 ift46 other downstream 3085844 27470086 ~ 27477978 (-)
G180188 dyrk1a,LOC108411986,LOC107572954 other upstream 382209 30946946 ~ 30957767 (-)
LOC103030555 LOC108423819,LOC107701125,LOC107718772,LOC107720543,LOC107556862,LOC107693906 other upstream 1329465 31894202 ~ 32071924 (-)
tmem135 tmem135,LOC107701128,LOC107718730 other upstream 1675442 32240179 ~ 32262598 (-)
tiam1 tiam1,LOC108423828,LOC107718732 other upstream 1871588 32436325 ~ 32584343 (-)
LOC103033173 NA other upstream 3240503 33805240 ~ 33855632 (-)

Expression


Co-expression Network