G68639



Basic Information


Item Value
gene id G68639
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 503594 ~ 503802 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU78206
TTGTATCTTAATTATGTCAGTCTCTAAGTCTTTCATTGACTGATTTAAAACTTTGGTGCTGTTGTGAGCATACTGCTGACAATACTGTTTAATCTGTATCTTACCAAAATCCCACCATTTTTGTACTGATTGAAAAGATACTTTTTTTGTTCTGTAATCAGCCCAAAACAATTTAAAAGTGCGTATAAAATCCTTTTTATCTAACAAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU78206 True 209 lncRNA 0.31 1 503594 503802

Neighbor


gene id symbol gene type direction distance location
CI01000012_00427641_00472235 NA coding downstream 31017 427573 ~ 472577 (-)
CI01000012_00382850_00384215 NA coding downstream 119168 381711 ~ 384426 (-)
CI01000012_00340814_00363240 HAAO coding downstream 140354 340665 ~ 363240 (-)
CI01000012_00260363_00261340 HCAR1-3 coding downstream 242086 260296 ~ 261508 (-)
CI01000012_00223417_00223713 NA coding downstream 279445 223215 ~ 224149 (-)
CI01000012_00520655_00552630 NA coding upstream 16337 520139 ~ 553820 (-)
CI01000012_00647774_00648451 NA coding upstream 143784 647586 ~ 648945 (-)
CI01000012_00686760_00686993 NA coding upstream 182719 686521 ~ 686993 (-)
CI01000012_00689933_00695237 NA coding upstream 185292 689094 ~ 695264 (-)
CI01000012_00863269_00864644 NA coding upstream 358238 862040 ~ 865072 (-)
G68638 NA non-coding downstream 1646 501422 ~ 501948 (-)
G68636 NA non-coding downstream 4513 498833 ~ 499081 (-)
G68628 NA non-coding downstream 14017 489254 ~ 489577 (-)
G68627 NA non-coding downstream 14544 488442 ~ 489050 (-)
G68617 NA non-coding downstream 42533 460844 ~ 461061 (-)
G68644 NA non-coding upstream 13856 517658 ~ 517865 (-)
G68623 NA non-coding upstream 23137 526939 ~ 527306 (-)
G69154 NA non-coding upstream 74182 577984 ~ 579539 (-)
G69157 NA non-coding upstream 78992 582794 ~ 583234 (-)
G69193 NA non-coding upstream 123540 627342 ~ 627685 (-)
CI01000012_00178282_00181473 NA other downstream 323632 178182 ~ 183012 (-)
G69150 NA other upstream 61661 565463 ~ 566956 (-)
G69161 NA other upstream 83802 587604 ~ 588015 (-)
G69277 NA other upstream 226118 729920 ~ 730465 (-)
G69332 NA other upstream 271562 775364 ~ 775879 (-)
CI01000012_01139864_01192154 TTC7A other upstream 631874 1135676 ~ 1192154 (-)

Expression



Co-expression Network