G180510


Basic Information

Item Value
gene id G180510
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 32451032 ~ 32488971 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU244497
aaattaaaaacctctggaatataatcaagaggaagatggatgatcacaaaccatcaaaccaccaaactgaactgcttgaaattttgcaccaggagtaaagcagcataaagttatccaaaagcagtgtgtaagactggtggaggagaacatgatgccgagatgcatgaaaactcattttctgtaaataaatgctctaaatg

Function

NR:

description
PREDICTED: regulator of G-protein signaling 7-like, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU244497 True 200 lncRNA 0.37 2 32451032 32488971

Neighbor

gene id symbol gene type direction distance location
bach1 NA coding upstream 128084 32306457 ~ 32322948 (+)
map3k7cl map3k7cl coding upstream 152087 32281279 ~ 32298945 (+)
LOC103040837 rab38,LOC103040837,LOC108423822,LOC108277304,LOC107701102,LOC107718792,LOC107557212,LOC107693892 coding upstream 245256 32190848 ~ 32205776 (+)
LOC103040533 grm5,grm5a,LOC108423821,LOC107693909,LOC107720647,LOC107718729 coding upstream 263303 32112356 ~ 32187729 (+)
LOC103030242 chordc1 coding upstream 364589 32073627 ~ 32086443 (+)
LOC111195090 NA coding downstream 154541 32643512 ~ 32650332 (+)
LOC103029275 NA coding downstream 198782 32687753 ~ 32691484 (+)
LOC103036259 NA coding downstream 215960 32704931 ~ 32709254 (+)
LOC103028331 frem2,frem2a,LOC107720635,LOC107701139,LOC108276566,LOC107555183 coding downstream 621020 33109991 ~ 33275686 (+)
LOC107197579 trim47,LOC108423837,LOC107701143,LOC107718738,LOC107557227,LOC107720633 coding downstream 797464 33286435 ~ 33297195 (+)
G180504 NA non-coding upstream 5408 32436370 ~ 32445624 (+)
G180490 NA non-coding upstream 120300 32329181 ~ 32330732 (+)
G180488 NA non-coding upstream 141455 32308529 ~ 32309577 (+)
G180472 NA non-coding upstream 237125 32213356 ~ 32213907 (+)
G180463 NA non-coding upstream 242477 32113044 ~ 32208555 (+)
G180521 NA non-coding downstream 113788 32602759 ~ 32603043 (+)
G180591 NA non-coding downstream 129574 32618545 ~ 32618824 (+)
G180595 sod1,LOC106604042 non-coding downstream 162361 32651332 ~ 32658387 (+)
G180612 NA non-coding downstream 311816 32800787 ~ 32802387 (+)
G180642 NA non-coding downstream 474970 32963941 ~ 32964260 (+)
G180460 cct8,LOC100304907,LOC107693911,LOC107701129 other upstream 177234 32264998 ~ 32273798 (+)
G180266 NA other upstream 1017123 31433198 ~ 31433909 (+)
G180235 erg other upstream 1299937 31139344 ~ 31151095 (+)
LOC103038954 zgc:101846,LOC106525086,LOC108416226,LOC101161532 other upstream 4925591 27524302 ~ 27525441 (+)
rnasek rnasek,LOC107554319 other upstream 5534688 26913750 ~ 26916344 (+)
ufm1 ufm1,LOC107701138 other downstream 561271 33050242 ~ 33067932 (+)
LOC103026201 LOC108277347,LOC108423746,LOC106604019 other downstream 1683953 34172924 ~ 34328970 (+)
LOC103024954 LOC108423745 other downstream 1845605 34334576 ~ 34507324 (+)
nsun5 nsun5,LOC102793237,LOC107686168 other downstream 2903550 35392521 ~ 35403624 (+)
LOC107197592 NA other downstream 3111512 35600483 ~ 35607593 (+)

Expression


Co-expression Network