G68623


Basic Information

Item Value
gene id G68623
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000012
NCBI id null
chromosome length 13770000
location 526939 ~ 527306 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU78190
GTCGTAGTTTAGATATATTTTTAAGATGGAAGAATGCGGTTTTACAGATGCTAGTAACATGGCCTTCAAATGAAAGATTGGTATCAAAAAGCACACCCAGGTTCCTAACTGACGACGAAGACTTAACAGAGCAGCCATCAAGTGTTAGACAATATTCTAGGTTATTACGTGAAGAAGTTTTTGGTCCAAAAATTAGAATCTCTGTTTTTTCTGAATTTAGTAGTAGGAAATTACTGGTCATCCAATTTTTTATATCAGCTATGCATTCCGTTAATTTTGTGAATTGGTAAGTTTCGTCAGGGCGCGAAGAAATATAGAGCTGAGTATCATCAGCGTAACAGTGAAAACTAACGCCATGCTTCCTAATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU78190 True 368 lncRNA 0.36 1 526939 527306

Neighbor

gene id symbol gene type direction distance location
CI01000012_00427641_00472235 NA coding downstream 54362 427573 ~ 472577 (-)
CI01000012_00382850_00384215 NA coding downstream 142513 381711 ~ 384426 (-)
CI01000012_00340814_00363240 HAAO coding downstream 163699 340665 ~ 363240 (-)
CI01000012_00260363_00261340 HCAR1-3 coding downstream 265431 260296 ~ 261508 (-)
CI01000012_00223417_00223713 NA coding downstream 302790 223215 ~ 224149 (-)
CI01000012_00647774_00648451 NA coding upstream 120280 647586 ~ 648945 (-)
CI01000012_00686760_00686993 NA coding upstream 159215 686521 ~ 686993 (-)
CI01000012_00689933_00695237 NA coding upstream 161788 689094 ~ 695264 (-)
CI01000012_00863269_00864644 NA coding upstream 334734 862040 ~ 865072 (-)
CI01000012_00866804_00867133 NA coding upstream 338679 865985 ~ 867133 (-)
G68644 NA non-coding downstream 9074 517658 ~ 517865 (-)
G68639 NA non-coding downstream 23137 503594 ~ 503802 (-)
G68638 NA non-coding downstream 24991 501422 ~ 501948 (-)
G68636 NA non-coding downstream 27858 498833 ~ 499081 (-)
G68628 NA non-coding downstream 37362 489254 ~ 489577 (-)
G69154 NA non-coding upstream 50678 577984 ~ 579539 (-)
G69157 NA non-coding upstream 55488 582794 ~ 583234 (-)
G69193 NA non-coding upstream 100036 627342 ~ 627685 (-)
G69222 NA non-coding upstream 130661 657967 ~ 658208 (-)
G69223 NA non-coding upstream 131871 659177 ~ 659462 (-)
CI01000012_00178282_00181473 NA other downstream 346977 178182 ~ 183012 (-)
G69150 NA other upstream 38157 565463 ~ 566956 (-)
G69161 NA other upstream 60298 587604 ~ 588015 (-)
G69277 NA other upstream 202614 729920 ~ 730465 (-)
G69332 NA other upstream 248058 775364 ~ 775879 (-)
CI01000012_01139864_01192154 TTC7A other upstream 608370 1135676 ~ 1192154 (-)

Expression


Co-expression Network