G180826


Basic Information

Item Value
gene id G180826
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 33598348 ~ 33599355 (+)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU244907
ttagggttaggtgtagggttagattttatggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggtaaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttatggttgattaagggttaaggttagggttagg
>TU244908
ttagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggtaaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttagggttgattaagggttaaggttagggttaggtgtagggtttgattttatggttgattaagggttaaggttagggttagg

Function

GO:

id name namespace
GO:0050878 regulation of body fluid levels biological_process
GO:0019538 protein metabolic process biological_process
GO:0030162 regulation of proteolysis biological_process
GO:0001775 cell activation biological_process
GO:0030168 platelet activation biological_process
GO:0007596 blood coagulation biological_process
GO:0007599 hemostasis biological_process
GO:0006508 proteolysis biological_process
GO:0050817 coagulation biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05020 Prion disease

RNA

RNA id representative length rna type GC content exon number start site end site
TU244907 False 203 lncRNA 0.39 3 33598348 33599355
TU244908 True 239 lncRNA 0.39 4 33598595 33599355

Neighbor

gene id symbol gene type direction distance location
LOC107197579 trim47,LOC108423837,LOC107701143,LOC107718738,LOC107557227,LOC107720633 coding upstream 301153 33286435 ~ 33297195 (+)
LOC103028331 frem2,frem2a,LOC107720635,LOC107701139,LOC108276566,LOC107555183 coding upstream 322662 33109991 ~ 33275686 (+)
LOC103036259 NA coding upstream 889094 32704931 ~ 32709254 (+)
LOC103029275 NA coding upstream 906864 32687753 ~ 32691484 (+)
LOC111195090 NA coding upstream 948016 32643512 ~ 32650332 (+)
synj1 NA coding downstream 259321 33858676 ~ 33905991 (+)
c20h21orf59 c10h21orf59,cunh21orf59,LOC103033817,LOC107691672,LOC105907446 coding downstream 311869 33911224 ~ 33918741 (+)
mis18a NA coding downstream 361601 33960956 ~ 33967651 (+)
LOC103026520 LOC108423747 coding downstream 409566 34008921 ~ 34123671 (+)
LOC103024324 kl coding downstream 913883 34513238 ~ 34530693 (+)
G180807 NA non-coding upstream 58926 33514522 ~ 33539422 (+)
G180804 NA non-coding upstream 131568 33466570 ~ 33466780 (+)
G180746 NA non-coding upstream 203019 33373574 ~ 33395329 (+)
G180734 NA non-coding upstream 283417 33314510 ~ 33314931 (+)
G180726 NA non-coding upstream 315307 33281657 ~ 33283041 (+)
G180894 NA non-coding downstream 205882 33805237 ~ 33847775 (+)
G180912 NA non-coding downstream 342534 33941889 ~ 33945586 (+)
G180913 NA non-coding downstream 346310 33945665 ~ 33948938 (+)
G180921 NA non-coding downstream 373589 33972944 ~ 33973145 (+)
G180931 NA non-coding downstream 406608 34005963 ~ 34006814 (+)
ufm1 ufm1,LOC107701138 other upstream 530416 33050242 ~ 33067932 (+)
G180460 cct8,LOC100304907,LOC107693911,LOC107701129 other upstream 1324550 32264998 ~ 32273798 (+)
G180266 NA other upstream 2164439 31433198 ~ 31433909 (+)
G180235 erg other upstream 2447253 31139344 ~ 31151095 (+)
LOC103038954 zgc:101846,LOC106525086,LOC108416226,LOC101161532 other upstream 6072907 27524302 ~ 27525441 (+)
LOC103026201 LOC108277347,LOC108423746,LOC106604019 other downstream 573569 34172924 ~ 34328970 (+)
LOC103024954 LOC108423745 other downstream 735221 34334576 ~ 34507324 (+)
nsun5 nsun5,LOC102793237,LOC107686168 other downstream 1793166 35392521 ~ 35403624 (+)
LOC107197592 NA other downstream 2001128 35600483 ~ 35607593 (+)
LOC103044041 NA other downstream 2085649 35685004 ~ 35702995 (+)

Expression


Co-expression Network