G180832


Basic Information

Item Value
gene id G180832
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035916.1
NCBI id CM008319.1
chromosome length 36262418
location 33598305 ~ 33662494 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU244915
gatttaaaatagaacctaacccaacacctaaccctaaccttaacccttaatcaaccataaaatcaaaccctacacctaaccctaaccttaacccttaatcaaccctaaaatcaaaccctacaccttaccctaaccttaacccttaatcaaccctaaaatcaaaccctacacctaaccctaaccttaacccttaatcaaccataaaatctaaccctacacctaaccctaaacccaatcctaaaatattaagataagcgtttggattagagttg

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process

KEGG:

id description
ko04610 Complement and coagulation cascades
ko05150 Staphylococcus aureus infection
ko05322 Systemic lupus erythematosus

RNA

RNA id representative length rna type GC content exon number start site end site
TU244915 True 272 lncRNA 0.37 4 33598305 33662494

Neighbor

gene id symbol gene type direction distance location
LOC107197574 arfip2b,LOC108438961,LOC108276920,LOC107557232,LOC107718740,LOC107555180 coding downstream 152190 33399355 ~ 33446115 (-)
LOC103027697 NA coding downstream 203040 33373500 ~ 33395265 (-)
LOC103028027 LOC108423836,LOC107701140,LOC107720632,LOC107557229,LOC107718737 coding downstream 230711 33303815 ~ 33367594 (-)
LOC111195091 NA coding downstream 420808 33176763 ~ 33177497 (-)
LOC103035222 trpc4,LOC108423767 coding downstream 670552 32872810 ~ 32927753 (-)
LOC107197575 NA coding upstream 171451 33833945 ~ 33835554 (-)
eva1c NA coding upstream 258870 33921364 ~ 33935796 (-)
hunk hunk,LOC108423838,LOC107734458,LOC107577711,LOC107691675,LOC104954747 coding upstream 324578 33987072 ~ 34001460 (-)
zar1l NA coding upstream 845965 34508459 ~ 34510759 (-)
rfc3 rfc3,LOC107589808,LOC107728889 coding upstream 870680 34533174 ~ 34540077 (-)
G180785 NA non-coding downstream 280237 33317845 ~ 33318068 (-)
G180778 NA non-coding downstream 314696 33283379 ~ 33283609 (-)
G180709 NA non-coding downstream 491840 33106160 ~ 33106465 (-)
G180707 NA non-coding downstream 511550 33086525 ~ 33086755 (-)
G180687 NA non-coding downstream 561945 33036060 ~ 33036360 (-)
G180889 NA non-coding upstream 100906 33763400 ~ 33763639 (-)
G180893 NA non-coding upstream 132169 33794663 ~ 33794995 (-)
G180949 NA non-coding upstream 176913 33839407 ~ 33886265 (-)
G180957 NA non-coding upstream 219077 33881571 ~ 33910371 (-)
G180965 NA non-coding upstream 223230 33885724 ~ 33923081 (-)
tiam1 tiam1,LOC108423828,LOC107718732 other downstream 1013962 32436325 ~ 32584343 (-)
tmem135 tmem135,LOC107701128,LOC107718730 other downstream 1335707 32240179 ~ 32262598 (-)
LOC103030555 LOC108423819,LOC107701125,LOC107718772,LOC107720543,LOC107556862,LOC107693906 other downstream 1526381 31894202 ~ 32071924 (-)
G180188 dyrk1a,LOC108411986,LOC107572954 other downstream 2640538 30946946 ~ 30957767 (-)
G179816 NA other downstream 4747200 28850690 ~ 28851105 (-)
LOC103033173 NA other upstream 142746 33805240 ~ 33855632 (-)
LOC103042595 LOC106931471,LOC106940241,LOC106603438,LOC107659943,LOC101067200 other upstream 1770738 35433232 ~ 35470789 (-)

Expression


Co-expression Network